ARL6 (NM_001278293) Human Untagged Clone

CAT#: SC334275

ARL6 (untagged) - Human ADP-ribosylation factor-like 6 (ARL6), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ARL6
• Synonyms: BBS3; RP55
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334275 representing NM_001278293.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGGATTGCTAGACAGACTTTCAGTCTTGCTTGGCCTGAAGAAGAAGGAGGTTCATGTTTTGTGCCTT
  GGGCTAGATAATAGTGGCAAAACGACGATCATTAACAAACTTAAACCTTCAAATGCTCAATCTCAAAAT
  ATCCTTCCAACAATAGGATTCAGCATAGAGAAATTCAAATCATCCAGTTTGTCATTTACAGTGTTTGAC
  ATGTCAGGTCAAGGAAGATACAGAAATCTCTGGGAACACTATTATAAAGAAGGCCAAGCTATTATTTTT
  GTCATTGATAGTAGTGATAGATTAAGAATGGTTGTGGCCAAAGAAGAACTCGATACTCTTCTGAATCAT
  CCAGATATTAAACACCGTCGAATTCCAATCTTATTCTTTGCAAATAAAATGGATCTTAGAGATGCAGTG
  ACATCTGTAAAAGTGTCTCAGTTGCTGTGTTTAGAGAACATCAAAGATAAACCCTGGCATATTTGTGCT
  AGTGATGCCATAAAAGGAGAAGGCTTGCAAGAAGGTGTAGACTGGCTTCAAGATCAGATCCAGACTGTG
  AAGACATGA
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278293
• Insert Size: 561 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278293.1
• RefSeq Size: 1531 bp
• RefSeq ORF: 561 bp
• Locus ID: 84100
• UniProt ID: Q9H0F7
• Cytogenetics: 3q11.2
• MW: 21.1 kDa
• Gene Summary: The protein encoded by this gene belongs to the ARF-like (ADP ribosylation factor-like) sub-family of the ARF family of GTP-binding proteins which are involved in regulation of intracellular traffic. Mutations in this gene are associated with Bardet-Biedl syndrome (BBS). A vision-specific transcript, encoding long isoform BBS3L, has been described (PMID: 20333246). [provided by RefSeq, Apr 2016]
  Transcript Variant: Variants 1, 2 and 3 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.