RABEP1 (NM_001291582) Human Untagged Clone

CAT#: SC334322

RABEP1 (untagged) - Human rabaptin, RAB GTPase binding effector protein 1 (RABEP1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RABEP1
• Synonyms: RAB5EP; RABPT5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334322 representing NM_001291582.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGCAGCCGGGCCCGGCTTCCCAGCCTGACGTTTCTCTTCAGCAACGGGTAGCAGAATTGGAAAAA
  ATTAATGCAGAATTTTTACGTGCACAACAGCAGCTTGAACAAGAATTTAATCAAAAGAGAGCAAAATTT
  AAGGAGTTATATTTGGCTAAAGAGGAGGATCTGAAGAGGCAAAATGCAGTATTACAAGCTGCACAAGAT
  GATTTGGGACACCTTCGAACCCAGCTGTGGGAAGCTCAAGCAGAGATGGAGAATATTAAGGCGATTGCC
  ACAGTCTCTGAGAACACCAAGCAAGAAGCTATAGATGAAGTGAAAAGACAGTGGAGAGAAGAAGTTGCT
  TCACTTCAGGCTGTTATGAAAGAAACAGTTCGTGACTATGAGCACCAGTTCCACCTTAGGCTGGAGCAG
  GAGCGAACACAGTGGGCACAGTATAGAGAATCCGCAGAGAGGGAAATAGCTGATTTAAGAAGAAGGCTG
  TCTGAAGGTCAAGAGGAGGAAAATTTAGAAAATGAAATGAAAAAGGATCCCATCCAGGATACCATATTG
  CATTTAGTTGTGTCTCCTTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001291582
• Insert Size: 573 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291582.1
• RefSeq Size: 972 bp
• RefSeq ORF: 573 bp
• Locus ID: 9135
• Cytogenetics: 17p13.2
• Protein Pathways: Endocytosis
• MW: 22.4 kDa
• Gene Summary: Rab effector protein acting as linker between gamma-adaptin, RAB4A and RAB5A. Involved in endocytic membrane fusion and membrane trafficking of recycling endosomes. Involved in KCNH1 channels trafficking to and from the cell membrane (PubMed:22841712). Stimulates RABGEF1 mediated nucleotide exchange on RAB5A. Mediates the traffic of PKD1:PKD2 complex from the endoplasmic reticulum through the Golgi to the cilium (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) lacks several 3' exons but contains an alternate 3' terminal exon, and it thus differs in its 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (4) has a distinct C-terminus and is significantly shorter than isoform 1.