CIB2 (NM_001301224) Human Untagged Clone

CAT#: SC334352

CIB2 (untagged) - Human calcium and integrin binding family member 2 (CIB2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CIB2
• Synonyms: DFNB48; KIP2; USH1J
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334352 representing NM_001301224.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGGGAACAAGCAGACCATCTTCACCGAAGAGCAGCTAGACAACTACCAGGACTGCACCTTCTTCAAT
  AAGAAGGACATCCTCAAATGGGGAAACCGAGGCTCAGAGGGATTTGGTCACTCCTCCAGGGTCACACAG
  GCTGTCCACAGTCTGGCTCCGGGGCCCTCCTGCTTATCCTGCACCCACAGTGATTGCTGTGTGTGTTTT
  CTTCAGGAGAATCCCTTCAAAGAAAGGATCGTGGCGGCGTTTTCCGAGGATGGTGAGGGGAACCTCACT
  TTCAACGACTTTGTGGACATGTTTTCCGTGCTCTGCGAGTCGGCTCCCCGAGAGCTCAAGGCAAACTAT
  GCCTTCAAGATCTATGACTTCAACACTGACAACTTCATCTGCAAGGAGGACCTGGAGCTGACGCTGGCC
  CGGCTCACTAAGTCAGAGCTGGATGAGGAGGAGGTGGTGCTTGTGTGCGACAAGGTCATTGAGGAGGCT
  GACTTGGACGGTGACGGCAAGCTGGGCTTTGCTGACTTCGAGGACATGATTGCCAAGGCCCCTGACTTC
  CTCAGCACTTTCCACATCCGGATCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001301224
• Insert Size: 579 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001301224.1
• RefSeq Size: 1638 bp
• RefSeq ORF: 579 bp
• Locus ID: 10518
• UniProt ID: O75838
• Cytogenetics: 15q25.1
• Protein Families: Druggable Genome
• MW: 21.7 kDa
• Gene Summary: The protein encoded by this gene is similar to that of KIP/CIB, calcineurin B, and calmodulin. The encoded protein is a calcium-binding regulatory protein that interacts with DNA-dependent protein kinase catalytic subunits (DNA-PKcs), and it is involved in photoreceptor cell maintenance. Mutations in this gene cause deafness, autosomal recessive, 48 (DFNB48), and also Usher syndrome 1J (USH1J). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (4) lacks an alternate exon and uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded isoform (4) is longer than isoform 1.