HMG4 (HMGB3) (NM_001301228) Human Untagged Clone

CAT#: SC334410

HMGB3 (untagged) - Human high mobility group box 3 (HMGB3), transcript variant 1


  "NM_001301228" in other vectors (1)

Reconstitution Protocol

USD 341.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Anti-HMGB3 Rabbit Polyclonal Antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "HMGB3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HMGB3
Synonyms HMG-2a; HMG-4; HMG2A; HMG4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334410 representing NM_001301228.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTAAAGGTGACCCCAAGAAACCAAAGGGCAAGATGTCCGCTTATGCCTTCTTTGTGCAGACATGC
AGAGAAGAACATAAGAAGAAAAACCCAGAGGTCCCTGTCAATTTTGCGGAATTTTCCAAGAAGTGCTCT
GAGAGGTGGAAGACGATGTCCGGGAAAGAGAAATCTAAATTTGATGAAATGGCAAAGGCAGATAAAGTG
CGCTATGATCGGGAAATGAAGGATTATGGACCAGCTAAGGGAGGCAAGAAGAAGAAGGATCCTAATGCT
CCCAAAAGGCCACCGTCTGGATTCTTCCTGTTCTGTTCAGAATTCCGCCCCAAGATCAAATCCACAAAC
CCCGGCATCTCTATTGGAGACGTGGCAAAAAAGCTGGGTGAGATGTGGAATAATTTAAATGACAGTGAA
AAGCAGCCTTACATCACTAAGGCGGCAAAGCTGAAGGAGAAGTATGAGAAGGATGTTGCTGACTATAAG
TCGAAAGGAAAGTTTGATGGTGCAAAGGGTCCTGCTAAAGTTGCCCGGAAAAAGGTGGAAGAGGAAGAT
GAAGAAGAGGAGGAGGAAGAAGAGGAGGAGGAGGAGGAGGAGGATGAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001301228
Insert Size 603 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301228.1
RefSeq Size 3676 bp
RefSeq ORF 603 bp
Locus ID 3149
UniProt ID O15347
Cytogenetics Xq28
Protein Families Transcription Factors
MW 23 kDa
Gene Summary This gene encodes a member of a family of proteins containing one or more high mobility group DNA-binding motifs. The encoded protein plays an important role in maintaining stem cell populations, and may be aberrantly expressed in tumor cells. A mutation in this gene was associated with microphthalmia, syndromic 13. There are numerous pseudogenes of this gene on multiple chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (1) represents the longest transcript and encodes the shorter isoform (a). Variants 1, 2, and 3 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.