Sigma1 receptor (SIGMAR1) (NM_001282207) Human Untagged Clone

CAT#: SC334428

SIGMAR1 (untagged) - Human sigma non-opioid intracellular receptor 1 (SIGMAR1), transcript variant 8


  "NM_001282207" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Antibody against OPRS1 (N-term)
    • 100 ug

USD 450.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "SIGMAR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SIGMAR1
Synonyms ALS16; DSMA2; hSigmaR1; OPRS1; SIG-1R; sigma1R; SR-BP; SR-BP1; SRBP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334428 representing NM_001282207.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGTGGGCCGTGGGCCGGCGGTGGGCGTGGGCCGCGCTGCTCCTGGCTGTCGCAGCGGTGCTGACC
CAGGTCGTCTGGCTCTGGCTGGGGCTGGACCACGAGCTGGCCTTCTCTCGTCTGATCGTGGAGCTGCGG
CGGCTGCACCCAGGCCACGTGCTGCCCGACGAGGAGCTGCAGTGGGTGTTCGTGAATGCGGGTGGCTGG
ATGGGCGCCATGTGCCTTCTGCACGCCTCGCTGTCCGAGTATGTGCTGCTCTTCGGCACCGCCTTGGGC
TCCCGCGGCCACTCGGGGCGCTACTGGGCTGAGATCTCGGATACCATCATCTCTGGCACCTTCCACCAG
TGGAGAGAGGGCACCACCAAAAGTGAGGTCTTCTACCCAGGGGAGACGGTAGTACACGGGCCTGGTGAG
GCAACAGCTGTGGAGTGGGGGCCAAACACATGGATGGTGGAGTACGGCCGGGGCGTCATCCCATCCACC
CTGGCCTTCGCGCTGGCCGACACTGTCTTCAGCACCCAGGACTTCCTCACCCTCTTCTATACTCTTCGC
TCCTATGCTCGGGGCCTCCGGCTTGAGCTCACCACCTACCTCTTTGGCCAGGACCCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001282207
Insert Size 612 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282207.1
RefSeq Size 1668 bp
RefSeq ORF 612 bp
Locus ID 10280
UniProt ID Q99720
Cytogenetics 9p13.3
Protein Families Druggable Genome, GPCR, Transmembrane
MW 22.8 kDa
Gene Summary This gene encodes a receptor protein that interacts with a variety of psychotomimetic drugs, including cocaine and amphetamines. The receptor is believed to play an important role in the cellular functions of various tissues associated with the endocrine, immune, and nervous systems. As indicated by its previous name, opioid receptor sigma 1 (OPRS1), the product of this gene was erroneously thought to function as an opioid receptor; it is now thought to be a non-opioid receptor. Mutations in this gene has been associated with juvenile amyotrophic lateral sclerosis 16. Alternative splicing of this gene results in transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (8) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded isoform (8) is shorter, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.