Centlein (CNTLN) (NM_001286984) Human Untagged Clone

CAT#: SC334431

CNTLN (untagged) - Human centlein, centrosomal protein (CNTLN), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CNTLN
• Synonyms: bA340N12.1; C9orf39; C9orf101
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334431 representing NM_001286984.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGGCGCGTTCGCCTCCCTCACCGCACCCTTCGCCCCCAGCGCGACAGCTGGGCCCCAGGTCCCCA
  CGTGTTGGGCGGGGAGCTGAAGTACACGCAATGCGCAGCGAGGCCTCGGGTTTTGCCGGCGCAGCGCGG
  GAGGTGGTCGCGGACGAAAGTGATAAAATCTGGGTGGGTGAAGAAGGGTCAGGGGGCCGGCGAGGGCCT
  GGGGGGGCAGCTCCGGCTCATGCTCCCCTCCTCAGCGCGCCCATGGGGTCCAGACGGCTAGAGGGCATC
  TCGGTAGAGGAGGCGATGGTGACCCGGACGCAGCTGCTGGAGGAAGAGCTGAGCAGCCTAAAGGAGGAG
  TTGGCCCTGTGTCAGGCTGATAAAGAATTTGTATGGTCTTTGTGGAAACGTCTCCAGGTTACAAACCCA
  GATCTCACACAAGTGGTCAGTTTGGTTGTGGAAAGGAGGCCACCGGAAGATGTGTACCACCAAAACGAA
  GAATATACCAAAAAAGATAAAAAGTTGGGATTGAGAAAATGTGAGATCCAACACATGAATAATATAAAG
  ATATTCCAAGGTGAAGATGAAAGAAGATTGAGAAGACTTGGTAGCAGTAGTTCTCAATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001286984
• Insert Size: 612 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286984.1
• RefSeq Size: 2269 bp
• RefSeq ORF: 612 bp
• Locus ID: 54875
• Cytogenetics: 9p22.2
• MW: 22.4 kDa
• Gene Summary: Required for centrosome cohesion and recruitment of CEP68 to centrosomes.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) lacks several exons in the central and 3' regions but includes an alternate 3' terminal exon, and it thus differs in its 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (3) has a distinct C-terminus and is significantly shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.