POLR3H (NM_001282885) Human Untagged Clone
CAT#: SC334434
POLR3H (untagged) - Human polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) (POLR3H), transcript variant 6
"NM_001282885" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | POLR3H |
Synonyms | C25; RPC8; RPC22.9 |
Vector | pCMV6-Entry |
Sequence Data |
>SC334434 representing NM_001282885.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGGAAGCTCAAC GACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTACAACGTGGGACTCTGCATT TGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTCCCTGGGGATGGCGCATCACACACCAAA GTCCATTTTCGCTGCGTGGTGTTTCATCCATTCCTAGATGAGATTCTCATTGGGAAGATCAAAGGCTGC AGCCCAGAAGGAGTGCACGTCTCTCTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAG CAGCCAGCCAAGTTCGACGAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACAC GACCTCTACATGGACACCGGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACGTCC CCCACAGGGCCCAGCTCAGCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAGGAGGCTCCGTAC ACGCTTGTGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCTGGTGGACCAGCAACTAG |
Restriction Sites | SgfI-MluI Plasmid Map |
ACCN | NM_001282885 |
Insert Size | 615 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282885.1 |
RefSeq Size | 4179 bp |
RefSeq ORF | 615 bp |
Locus ID | 171568 |
UniProt ID | Q9Y535 |
Cytogenetics | 22q13.2 |
Protein Families | Transcription Factors |
Protein Pathways | Cytosolic DNA-sensing pathway, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase |
MW | 22.9 kDa |
Gene Summary | DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Specific peripheric component of RNA polymerase III which synthesizes small RNAs, such as 5S rRNA and tRNAs. Plays a key role in sensing and limiting infection by intracellular bacteria and DNA viruses. Acts as nuclear and cytosolic DNA sensor involved in innate immune response. Can sense non-self dsDNA that serves as template for transcription into dsRNA. The non-self RNA polymerase III transcripts, such as Epstein-Barr virus-encoded RNAs (EBERs) induce type I interferon and NF- Kappa-B through the RIG-I pathway (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (6) differs in the 5' UTR, compared to variant 1. Variants 1, 3, 5, and 6 encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236540 | POLR3H (myc-DDK-tagged) - Human polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) (POLR3H), transcript variant 6 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review