POLR3H (NM_001282885) Human Untagged Clone

CAT#: SC334434

POLR3H (untagged) - Human polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) (POLR3H), transcript variant 6


  "NM_001282885" in other vectors (1)

Reconstitution Protocol

USD 341.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
POLR3H mouse monoclonal antibody,clone OTI4D8
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "POLR3H"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol POLR3H
Synonyms C25; RPC8; RPC22.9
Vector pCMV6-Entry
Sequence Data
>SC334434 representing NM_001282885.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGGAAGCTCAAC
GACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTACAACGTGGGACTCTGCATT
TGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTCCCTGGGGATGGCGCATCACACACCAAA
GTCCATTTTCGCTGCGTGGTGTTTCATCCATTCCTAGATGAGATTCTCATTGGGAAGATCAAAGGCTGC
AGCCCAGAAGGAGTGCACGTCTCTCTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAG
CAGCCAGCCAAGTTCGACGAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACAC
GACCTCTACATGGACACCGGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACGTCC
CCCACAGGGCCCAGCTCAGCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAGGAGGCTCCGTAC
ACGCTTGTGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCTGGTGGACCAGCAACTAG

Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001282885
Insert Size 615 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282885.1
RefSeq Size 4179 bp
RefSeq ORF 615 bp
Locus ID 171568
UniProt ID Q9Y535
Cytogenetics 22q13.2
Protein Families Transcription Factors
Protein Pathways Cytosolic DNA-sensing pathway, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
MW 22.9 kDa
Gene Summary DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Specific peripheric component of RNA polymerase III which synthesizes small RNAs, such as 5S rRNA and tRNAs. Plays a key role in sensing and limiting infection by intracellular bacteria and DNA viruses. Acts as nuclear and cytosolic DNA sensor involved in innate immune response. Can sense non-self dsDNA that serves as template for transcription into dsRNA. The non-self RNA polymerase III transcripts, such as Epstein-Barr virus-encoded RNAs (EBERs) induce type I interferon and NF- Kappa-B through the RIG-I pathway (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) differs in the 5' UTR, compared to variant 1. Variants 1, 3, 5, and 6 encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.