ETNK2 (NM_001297761) Human Untagged Clone

CAT#: SC334472

ETNK2 (untagged) - Human ethanolamine kinase 2 (ETNK2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ETNK2
• Synonyms: EKI2; HMFT1716
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334472 representing NM_001297761.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCAAAGATTCATACTATCCACGCCAACGGCAGCCTGCCCAAGCCCATCCTCTGGCACAAGATGCAC
  AATTATTTCACGCTTGTGAAGAACGAGATCAACCCCAGCCTTTCTGCAGATGTCCCTAAGGTAGAGGTG
  TTGGAACGGGAGCTGGCCTGGCTGAAGGAGCATCTGTCCCAGCTGGAGTCCCCTGTGGTGTTTTGTCAC
  AATGACCTGCTCTGCAAGAATATCATCTATGACAGCATCAAAGGTCACGTGCGGTTCATTGACTATGAA
  TATGCTGGCTACAACTACCAAGCTTTTGACATTGGCAACCATTTCAATGAGTTTGCAGGCGTGAATGAG
  GTGGATTACTGCCTGTACCCGGCGCGGGAGACCCAGCTGCAGTGGCTGCACTACTACCTGCAGGCACAA
  AAGGGGATGGCCGTGACCCCCAGGGAGGTGCAAAGGCTCTACGTGCAAGTCAACAAGTTTGCCCTGGCG
  TCTCACTTCTTCTGGGCTCTCTGGGCCCTCATCCAGAACCAGTACTCCACCATCGACTTTGATTTCCTC
  AGGTACGCAGTGATCCGATTCAACCAGTACTTCAAGGTGAAGCCTCAAGCGTCAGCCTTGGAGATGCCA
  AAGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001297761
• Insert Size: 627 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001297761.1
• RefSeq Size: 2378 bp
• RefSeq ORF: 627 bp
• Locus ID: 55224
• UniProt ID: Q9NVF9
• Cytogenetics: 1q32.1
• Protein Families: Druggable Genome
• Protein Pathways: Glycerophospholipid metabolism, Metabolic pathways
• MW: 24.5 kDa
• Gene Summary: The protein encoded by this gene is a member of choline/ethanolamine kinase family which catalyzes the first step of phosphatidylethanolamine (PtdEtn) biosynthesis via the cytidine diphosphate (CDP) ethanolamine pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (3) lacks an alternate exon in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus than isoform 1.