GBGT1 (NM_001288573) Human Untagged Clone

CAT#: SC334492

GBGT1 (untagged) - Human globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 (GBGT1), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GBGT1
• Synonyms: A3GALNT; FS; UNQ2513
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334492 representing NM_001288573.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCGTGGGTACCGGGTGCACTACTACATCTTCACTGACAACCCTGCAGCCGTTCCCGGGGTCCCGCTG
  GGTCCCCACCGGCTTCTCAGCTCCATCCCCATCCAGGGTCACTCCCACTGGGAGGAGACATCCATGCGC
  CGGATGGAGACCATCAGCCAGCACATTGCTAAGAGGGCTCACCGGGAGGTGGACTACCTCTTCTGCCTT
  GATGTGGACATGGTGTTTCGGAACCCGTGGGGCCCTGAGACCTTGGGAGACCTGGTGGCTGCCATTCAC
  CCAAGCTACTACGCCGTTCCCCGCCAGCAGTTCCCCTATGAGCGCAGGCGTGTTTCCACTGCCTTTGTG
  GCAGACAGCGAAGGGGACTTCTATTATGGTGGGGCAGTCTTCGGGGGGCAGGTGGCCAGGGTATATGAG
  TTTACTAGGGGCTGCCACATGGCCATCCTGGCGGACAAGGCCAATGGCATCATGGCTGCCTGGCGGGAG
  GAAAGCCACCTGAACCGTCACTTCATCTCAAACAAGCCGTCCAAGGTGCTGTCCCCCGAGTACCTCTGG
  GACGACAGGAAGCCCCAGCCACCCAGCCTGAAGCTGATCCGCTTTTCTACACTGGACAAGGATATCAGC
  TGCCTGAGGAGCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001288573
• Insert Size: 636 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001288573.1
• RefSeq Size: 2035 bp
• RefSeq ORF: 636 bp
• Locus ID: 26301
• UniProt ID: Q8N5D6
• Cytogenetics: 9q34.2
• Protein Families: Transmembrane
• Protein Pathways: Glycosphingolipid biosynthesis - globo series, Metabolic pathways
• MW: 24.3 kDa
• Gene Summary: This gene encodes a glycosyltransferase that plays a role in the synthesis of Forssman glycolipid (FG), a member of the globoseries glycolipid family. Glycolipids such as FG form attachment sites for the binding of pathogens to cells; expression of this protein may determine host tropism to microorganisms. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
  Transcript Variant: This variant (5) uses an alternate splice site in the 3' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (5) has a shorter N-terminus than isoform 1.