AMD1 (NM_001287216) Human Untagged Clone

CAT#: SC334521

AMD1 (untagged) - Human adenosylmethionine decarboxylase 1 (AMD1), transcript variant 5


  "NM_001287216" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Anti-AMD1 rabbit polyclonal antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "AMD1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AMD1
Synonyms ADOMETDC; AMD; SAMDC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334521 representing NM_001287216.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAGCTGCACATTTTTTCGAAGGGACCGAGAAGCTGCTGGAGGTTTGGTTCTCCCGGCAGCAGCCC
GACGCAAACCAAGGATCTGGGGATCTTCGCACTATCCCAAGGTACTTATATACTCTGGATTTCCCAGAG
AGTCGGGTAATCAGTCAGCCAGATCAAACCTTGGAAATTCTGATGAGTGAGCTTGACCCAGCAGTTATG
GACCAGTTCTACATGAAAGATGGTGTTACTGCAAAGGATGTCACTCGTGAGAGTGGAATTCGTGACCTG
ATACCAGGTTCTGTCATTGATGCCACAATGTTCAATCCTTGTGGGTATTCGATGAATGGAATGAAATCG
GATGGAACTTATTGGACTATTCACATCACTCCAGAACCAGAATTTTCTTATGTTAGCTTTGAAACAAAC
TTAAGTCAGACCTCCTATGATGACCTGATCAGGAAAGTTGTAGAAGTCTTCAAGCCAGGAAAATTTGTG
ACCACCTTGTTTGTTAATCAGAGTTCTAAATGTCGCACAGTGCTTGCTTCGCCCCAGAAGATTGAAGGT
TTTAAGCGTCTTGATTGCCAGAGTGCTATGTTCAATGATTACAATTTTGTTTTTACCAGTTTTGCTAAG
AAGCAGCAACAACAGCAGAGTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001287216
Insert Size 645 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287216.1
RefSeq Size 3077 bp
RefSeq ORF 645 bp
Locus ID 262
Cytogenetics 6q21
Protein Families Druggable Genome
Protein Pathways Arginine and proline metabolism, Cysteine and methionine metabolism, Metabolic pathways
MW 24.5 kDa
Gene Summary This gene encodes an important intermediate enzyme in polyamine biosynthesis. The polyamines spermine, spermidine, and putrescine are low-molecular-weight aliphatic amines essential for cellular proliferation and tumor promotion. Multiple alternatively spliced transcript variants have been identified. Pseudogenes of this gene are found on chromosomes 5, 6, 10, X and Y. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (5) lacks consecutive four exons in the coding region, but maintains the reading frame, compared to variant 1. The resulting isoform (5) lacks an internal segment, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.