STX10 (NM_001271609) Human Untagged Clone

CAT#: SC334564

STX10 (untagged) - Human syntaxin 10 (STX10), transcript variant 2


  "NM_001271609" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-STX10 Antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "STX10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol STX10
Synonyms hsyn10; SYN10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334564 representing NM_001271609.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTCTCGAAGACCCCTTTTTTGTAGTCCGAGGCGAGGTGCAGAAGGCGGTGAACACGGCCCGCGGG
CTGTACCAGCGCTGGTGCGAGCTCCTGCAGGAAAGCGCGGCGGTCGGACGCGAGGAGCTGGACTGGACG
ACCAATGAGCTGCGGAATGGCCTGCGCAGCATCGAGTGGGACCTCGAGGACCTGGAAGAGACCATCGGT
ATAGTGGAAGCCAACCCAGGCAAGTTCAAGCTCCCAGCCGGGGACCTGCAGGAGAGAAAGGTGTTCGTG
GAGCGGATGCGAGAGGCAGTCCAGGAAATGAAGGACCATATGGTCAGCCCAACAGCCGTAGCATTTTTG
GAGAGGAATAACAGAGAGATACTCGCAGGCAAGCCAGCTGCCCAGAAGTCACCCAGCGACCTGCTGGAT
GCCAGCGCAGTCTCGGCCACATCTCGCTACATCGAGGAGCAGCAGGCCACACAGCAGCTGATCATGGAT
GAACAGGATCAACAGCTGGAGATGGTGTCTGGGAGCATCCAGGTTCTGAAGCACATGTCCGGCCGCGTT
GGAGAAGAGCTGGACGAGCAGGCATGCTGGATGCCTTCGCCCAAGAGATGGACCACACCCAGTCCCGCA
TGGACGGGGTCCTCAGGAAGTTGGCCAAAGTATCCCACATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001271609
Insert Size 663 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271609.1
RefSeq Size 1316 bp
RefSeq ORF 663 bp
Locus ID 8677
Cytogenetics 19p13.13
Protein Families Druggable Genome, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
MW 24.9 kDa
Gene Summary This gene belongs to the syntaxin family and encodes a soluble N-ethylmaleimide sensitive factor attachment protein receptor (SNARE). The encoded protein is involved in docking and fusion events at the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.