METTL11A (NTMT1) (NM_001286799) Human Untagged Clone

CAT#: SC334592

NTMT1 (untagged) - Human N-terminal Xaa-Pro-Lys N-methyltransferase 1 (NTMT1), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NTMT1
• Synonyms: AD-003; C9orf32; HOMT1A; METTL11A; NRMT; NRMT1; NTM1A
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334592 representing NM_001286799.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGACGAGCGAGGTGATAGAAGACGAGAAGCAATTCTATTCCAAGGCCAAGACCTACTGGAAACAAATC
  CCACCCACGGTGGACGGCATGCTTGGGGGGTATGGCCACATCTCCAGCATCGACATCAACAGCTCCCGG
  AAGTTTCTGCAGAGGTTTTTGAGGGAAGGCCCGAACAAGACAGGAACGTCCTGTGCCCTGGACTGTGGA
  GCTGGCATTGGGAGGATCACCAAGCGGCTGCTCCTGCCGCTGTTCAGAGAGGTGGATATGGTCGACATA
  ACGGAGGACTTCCTGGTTCAAGCCAAGACCTACCTGGGGGAGGAGGGCAAGAGGGTGAGGAACTACTTC
  TGTTGTGGGCTCCAGGACTTCACCCCGGAGCCGGACTCTTACGACGTGATCTGGATCCAGTGGGTGATA
  GGCCACCTCACCGATCAGCACCTGGCCGAGTTCCTGCGGCGCTGCAAGGGCAGCCTCCGCCCCAACGGC
  ATCATCGTCATCAAAGACAACATGGCCCAGGAGGGCGTGATTCTGGACGACGTGGACAGCAGCGTGTGC
  CGGGACCTTGACGTGGTCCGCAGGATCATCTGCAGTGCAGGCCTCAGCCTCCTGGCCGAGGAGAGGCAG
  GAGAACCTCCCCGATGAGATCTACCATGTCTATAGCTTTGCCCTGAGATGA
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001286799
• Insert Size: 672 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286799.1
• RefSeq Size: 1491 bp
• RefSeq ORF: 672 bp
• Locus ID: 28989
• UniProt ID: Q9BV86
• Cytogenetics: 9q34.11
• Protein Families: Druggable Genome
• MW: 25.4 kDa
• Gene Summary: The METTL11A gene encodes an N-terminal methyltransferase for the RAN (MIM 601179) guanine nucleotide exchange factor regulator of chromosome condensation 1 (RCC1; MIM 179710). METTL11A enzyme alpha-N-methylates other protein targets such as SET (MIM 600960) and RB (MIM 180200).[supplied by OMIM, Nov 2010]
  Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1 through 5 all encode isoform a.