OBP2A (NM_001293189) Human Untagged Clone

CAT#: SC334623

OBP2A (untagged) - Human odorant binding protein 2A (OBP2A), transcript variant gamma

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OBP2A
• Synonyms: hOBPIIa; LCN13; OBP; OBP2C; OBPIIa
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334623 representing NM_001293189.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAAGACCCTGTTCCTGGGTGTCACGCTCGGCCTGGCCGCTGCCCTGTCCTTCACCCTGGAGGAGGAG
  GATATCACAGGGACCTGGTACGTGAAGGCCATGGTGGTCGATAAGGACTTTCCGGAGGACAGGAGGCCC
  AGGAAGGTGTCCCCAGTGAAGGTGACAGCCCTGGGCGGTGGGAACTTGGAAGCCACGTTCACCTTCATG
  AGGGAGGATCGGTGCATCCAGAAGAAAATCCTGATGCGGAAGACGGAGGAGCCTGGCAAATTCAGCGCC
  TATGGGGGCAGGAAGCTCATATACCTGCAGGAGCTGCCCGGGACGGACGACTACGTCTTTTACTGCAAA
  GACCAGCGCCGTGGGGGCCTGCGCTACATGGGAAAGCTTGTGGCATCTGCTCCCTGCAGGGCCGTGCCG
  CTGTCCCCACCTTGGCTCACCTGGCCACCTCACCTGCAGGTAGGAATCCTAATACCAACCTGGAGGCCC
  TGGAAGAATTTAAGAAATTGGTGCAGCACAAGGGACTCTCGGAGGAGGACATTTTCATGCCCCTGCAGA
  CGGGAAGCTGCGTTCTCGAACACTAGGCAGCCCCCGGGTCTGCACCTCCAGAGCCCACCCTACCACCAG
  ACACAGAGCCCGGACCACCTGGACCTACCCTCCAGCCATGACCCTTCCCTGCTCCCACCCACCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001293189
• Insert Size: 687 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001293189.1
• RefSeq Size: 754 bp
• RefSeq ORF: 687 bp
• Locus ID: 29991
• UniProt ID: Q9NY56
• Cytogenetics: 9q34.3
• Protein Families: Secreted Protein
• MW: 26 kDa
• Gene Summary: This gene encodes a small extracellular protein belonging to the lipocalin superfamily. The protein is thought to transport small, hydrophobic, volatile molecules or odorants through the nasal mucus to olfactory receptors, and may also function as a scavenger of highly concentrated or toxic odors. The protein is expressed as a monomer in the nasal mucus, and can bind diverse types of odorants with a higher affinity for aldehydes and fatty acids. This gene and a highly similar family member are located in a cluster of lipocalin genes on chromosome 9. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (gamma, PMID:10607840) represents the longest transcript and encodes the longest isoform (gamma).