LRAT (NM_001301645) Human Untagged Clone

CAT#: SC334641

LRAT (untagged) - Human lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) (LRAT), transcript variant 2


  "NM_001301645" in other vectors (1)

Reconstitution Protocol

USD 341.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit polyclonal anti-LRAT antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "LRAT"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LRAT
Synonyms LCA14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334641 representing NM_001301645.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGAACCCCATGCTGGAGGTGGTGTCTTTACTACTGGAGAAGCTGCTCCTCATCTCCAACTTCACG
CTCTTTAGTTCGGGCGCCGCGGGCGAAGACAAAGGGAGGAACAGTTTTTATGAAACCAGCTCTTTCCAC
CGAGGCGACGTGCTGGAGGTGCCCCGGACCCACCTGACCCACTATGGCATCTACCTAGGAGACAACCGT
GTTGCCCACATGATGCCCGACATCCTGTTGGCCCTGACAGACGACATGGGGCGCACGCAGAAGGTGGTC
TCCAACAAGCGTCTCATCCTGGGCGTTATTGTCAAAGTGGCCAGCATCCGCGTGGACACAGTGGAGGAC
TTCGCCTACGGAGCTAACATCCTGGTCAATCACCTGGACGAGTCCCTCCAGAAAAAGGCACTGCTCAAC
GAGGAGGTGGCGCGGAGGGCTGAAAAGCTGCTGGGCTTTACCCCCTACAGCCTGCTGTGGAACAACTGC
GAGCACTTCGTGACCTACTGCAGATATGGCACCCCGATCAGTCCCCAGTCCGACAAGTTTTGTGAGACT
GTGAAGATAATTATTCGTGATCAGAGAAGTGTTCTTGCTTCAGCAGTCTTGGGATTGGCGTCTATAGTC
TGTACGGGCTTGGTATCATACACTACCCTTCCTGCAATTTTTATTCCATTCTTCCTATGGATGGCTGGC
TAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001301645
Insert Size 693 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301645.1
RefSeq Size 4735 bp
RefSeq ORF 693 bp
Locus ID 9227
UniProt ID O95237
Cytogenetics 4q32.1
Protein Families Druggable Genome, Transmembrane
Protein Pathways Retinol metabolism
MW 25.7 kDa
Gene Summary The protein encoded by this gene localizes to the endoplasmic reticulum, where it catalyzes the esterification of all-trans-retinol into all-trans-retinyl ester. This reaction is an important step in vitamin A metabolism in the visual system. Mutations in this gene have been associated with early-onset severe retinal dystrophy and Leber congenital amaurosis 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.