Acid Phosphatase 2 (ACP2) (NM_001302492) Human Untagged Clone

CAT#: SC334692

ACP2 (untagged) - Human acid phosphatase 2, lysosomal (ACP2), transcript variant 6


  "NM_001302492" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-ACP2 Antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "ACP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ACP2
Synonyms LAP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334692 representing NM_001302492.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGGCCAACGAGACAGGGCTTACAGACCTGACACTGGAGACCGTCTGGAATGTCTATGACACACTC
TTCTGTGAGCAAACGCACGGGCTGCGCCTGCCGCCCTGGGCCTCACCCCAAACCATGCAGCGTCTCAGC
CGGCTAAAGGACTTCAGCTTCCGCTTCCTCTTCGGAATCTACCAGCAGGCGGAGAAGGCCCGGCTTCAG
GGGGGAGTCCTGCTGGCTCAGATAAGGAAGAACCTGACCCTAATGGCGACCACCTCCCAGCTCCCCAAG
CTGCTGGTTTACTCTGCGCACGACACTACCCTGGTTGCCCTGCAAATGGCACTGGATGTCTACAATGGT
GAACAAGCCCCCTACGCCTCCTGCCACATATTTGAACTGTACCAGGAAGATTCTGGGAATTTCTCAGTG
GAGATGTACTTTCGGAACGAGAGTGACAAGGCCCCCTGGCCGCTCAGCCTGCCTGGCTGCCCTCACCGC
TGCCCACTGCAGGACTTCCTTCGCCTCACAGAGCCCGTCGTGCCCAAGGATTGGCAGCAGGAGTGCCAG
CTGGCAAGCGGTCCTGCAGACACAGAGGTGATTGTGGCCTTGGCTGTATGTGGCTCCATCCTCTTCCTC
CTCATAGTGCTGCTCCTCACCGTCCTCTTCCGGATGCAGGCCCAGCCTCCTGGCTACCGCCACGTCGCA
GATGGGGAGGACCACGCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001302492
Insert Size 711 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001302492.1
RefSeq Size 2088 bp
RefSeq ORF 711 bp
Locus ID 53
UniProt ID P11117
Cytogenetics 11p11.2|11p12-p11
Protein Families Druggable Genome, Transmembrane
Protein Pathways Lysosome, Riboflavin metabolism
MW 26.6 kDa
Gene Summary The protein encoded by this gene belongs to the histidine acid phosphatase family, which hydrolyze orthophosphoric monoesters to alcohol and phosphate. This protein is localized to the lysosomal membrane, and is chemically and genetically distinct from the red cell acid phosphatase. Mice lacking this gene showed multiple defects, including bone structure alterations, lysosomal storage defects, and an increased tendency towards seizures. An enzymatically-inactive allele of this gene in mice showed severe growth retardation, hair-follicle abnormalities, and an ataxia-like phenotype. Alternatively spliced transcript variants have been found for this gene. A C-terminally extended isoform is also predicted to be produced by the use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism. [provided by RefSeq, Oct 2017]
Transcript Variant: This variant (6) lacks an internal exon and uses an alternate acceptor splice site in the 5' region compared to variant 1. These differences result in translation initiation at an in-frame downstream start codon compared to variant 1. The encoded isoform (6) has a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.