CDK2 (NM_001290230) Human Untagged Clone

CAT#: SC334717

CDK2 (untagged) - Human cyclin-dependent kinase 2 (CDK2), transcript variant 3


  "NM_001290230" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
CDK2 mouse monoclonal antibody, clone OTI2D9 (formerly 2D9)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "CDK2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CDK2
Synonyms CDKN2; p33(CDK2)
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334717 representing NM_001290230.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGAACTTCCAAAAGGTGGAAAAGATCGGAGAGGGCACGTACGGAGTTGTGTACAAAGCCAGAAAC
AAGTTGACGGGAGAGGTGGTGGCGCTTAAGAAAATCCGCCTGGACACGCTGCTGGATGTCATTCACACA
GAAAATAAACTCTACCTGGTTTTTGAATTTCTGCACCAAGATCTCAAGAAATTCATGGATGCCTCTGCT
CTCACTGGCATTCCTCTTCCCCTCATCAAGAGCTATCTGTTCCAGCTGCTCCAGGGCCTAGCTTTCTGC
CATTCTCATCGGGTCCTCCACCGAGACCTTAAACCTCAGAATCTGCTTATTAACACAGAGGGGGCCATC
AAGCTAGCAGACTTTGGACTAGCCAGAGCTTTTGGAGTCCCTGTTCGTACTTACACCCATGAGGTGACT
CGCCGGGCCCTATTCCCTGGAGATTCTGAGATTGACCAGCTCTTCCGGATCTTTCGGACTCTGGGGACC
CCAGATGAGGTGGTGTGGCCAGGAGTTACTTCTATGCCTGATTACAAGCCAAGTTTCCCCAAGTGGGCC
CGGCAAGATTTTAGTAAAGTTGTACCTCCCCTGGATGAAGATGGACGGAGCTTGTTATCGCAAATGCTG
CACTACGACCCTAACAAGCGGATTTCGGCCAAGGCAGCCCTGGCTCACCCTTTCTTCCAGGATGTGACC
AAGCCAGTACCCCATCTTCGACTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001290230
Insert Size 717 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290230.1
RefSeq Size 2121 bp
RefSeq ORF 717 bp
Locus ID 1017
UniProt ID P24941
Cytogenetics 12q13.2
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Cell cycle, Oocyte meiosis, p53 signaling pathway, Pathways in cancer, Progesterone-mediated oocyte maturation, Prostate cancer, Small cell lung cancer
MW 27.2 kDa
Gene Summary This gene encodes a member of a family of serine/threonine protein kinases that participate in cell cycle regulation. The encoded protein is the catalytic subunit of the cyclin-dependent protein kinase complex, which regulates progression through the cell cycle. Activity of this protein is especially critical during the G1 to S phase transition. This protein associates with and regulated by other subunits of the complex including cyclin A or E, CDK inhibitor p21Cip1 (CDKN1A), and p27Kip1 (CDKN1B). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (3) lacks two alternate in-frame exons, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.