CRF1 (CRHR1) (NM_001303018) Human Untagged Clone

CAT#: SC334737

CRHR1 (untagged) - Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 1e

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CRHR1
• Synonyms: CRF-R; CRF-R-1; CRF-R1; CRF1; CRFR-1; CRFR1; CRH-R-1; CRH-R1; CRHR; CRHR1L
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334737 representing NM_001303018.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGCCCCGAGGTCCACCAGAGCAACGTGGGCTGGTGCAGGTTGGTGACAGCCGCCTACAACTACTTC
  CATGTGACCAACTTCTTCTGGATGTTCGGCGAGGGCTGCTACCTGCACACAGCCATCGTGCTCACCTAC
  TCCACTGACCGGCTGCGCAAATGGATGTTCATCTGCATTGGCTGGGGTGTGCCCTTCCCCATCATTGTG
  GCCTGGGCCATTGGGAAGCTGTACTACGACAATGAGAAGTGCTGGTTTGGCAAAAGGCCTGGGGTGTAC
  ACCGACTACATCTACCAGGGCCCCATGATCCTGGTCCTGCTGATCAATTTCATCTTCCTTTTCAACATC
  GTCCGCATCCTCATGACCAAGCTCCGGGCATCCACCACGTCTGAGACCATTCAGTACAGGAAGGCTGTG
  AAAGCCACTCTGGTGCTGCTGCCCCTCCTGGGCATCACCTACATGCTGTTCTTCGTCAATCCCGGGGAG
  GATGAGGTCTCCCGGGTCGTCTTCATCTACTTCAACTCCTTCCTGGAATCCTTCCAGGGCTTCTTTGTG
  TCTGTGTTCTACTGTTTCCTCAATAGTGAGGTCCGTTCTGCCATCCGGAAGAGGTGGCACCGGTGGCAG
  GACAAGCACTCGATCCGTGCCCGAGTGGCCCGTGCCATGTCCATCCCCACCTCCCCAACCCGTGTCAGC
  TTTCACAGCATCAAGCAGTCCACAGCAGTCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001303018
• Insert Size: 723 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001303018.1
• RefSeq Size: 2388 bp
• RefSeq ORF: 723 bp
• Locus ID: 1394
• UniProt ID: P34998
• Cytogenetics: 17q21.31
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Protein Pathways: Long-term depression, Neuroactive ligand-receptor interaction
• MW: 28.1 kDa
• Gene Summary: This gene encodes a G-protein coupled receptor that binds neuropeptides of the corticotropin releasing hormone family that are major regulators of the hypothalamic-pituitary-adrenal pathway. The encoded protein is essential for the activation of signal transduction pathways that regulate diverse physiological processes including stress, reproduction, immune response and obesity. Alternative splicing results in multiple transcript variants. Naturally-occurring readthrough transcription between this gene and upstream GeneID:147081 results in transcripts that encode isoforms that share similarity with the products of this gene. [provided by RefSeq, Aug 2016]
  Transcript Variant: This variant (1e, also known as CRH-R1e) lacks three alternate exons, and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1b. The encoded isoform (1e-B) is shorter at the N-terminus, compared to isoform 1.