C6orf89 (NM_001286636) Human Untagged Clone

CAT#: SC334746

C6orf89 (untagged) - Human chromosome 6 open reading frame 89 (C6orf89), transcript variant 3


  "NM_001286636" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "C6orf89"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol C6orf89
Synonyms BRAP; PS1TP5TP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334746 representing NM_001286636.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCTTGCCCATTGCCAAGAAGTACATGTCAGAAAATAAGGGAGTTCCTCTGCATGGGGGTGATGAA
GACAGACCCTTTCCAGACTTTGACCCCTGGTGGACAAACGACTGTGAGCAGAATGAGTCAGAGCCCATT
CCTGCCAACTGCACTGGCTGTGCCCAGAAACACCTGAAGGTGATGCTCCTGGAAGACGCCCCAAGGAAA
TTTGAGAGGCTCCATCCACTGGTGATCAAGACGGGAAAGCCCCTGTTGGAGGAAGAGATTCAGCATTTT
TTGTGCCAGTACCCTGAGGCGACAGAAGGCTTCTCTGAAGGGTTTTTCGCCAAGTGGTGGCGCTGCTTT
CCTGAGCGGTGGTTCCCATTTCCTTATCCATGGAGGAGACCTCTGAACAGATCACAAATGTTACGTGAG
CTTTTTCCTGTTTTCACTCACCTGCCATTTCCAAAAGATGCCTCTTTAAACAAGTGCTCCTTTCTTCAC
CCAGAACCTGTTGTGGGGAGTAAGATGCATAAGATGCCTGACCTATTTATCATTGGCAGCGGTGAGGCC
ATGTTGCAGCTCATCCCTCCCTTCCAGTGCCGAAGACATTGTCAGTCTGTGGCCATGCCAATAGAGCCA
GGGGATATCGGCTATGTCGACACCACCCACTGGAAGGTCTACGTTATAGCCAGAGGGGTCCAGCCTTTG
GTCATCTGCGATGGAACCGCTTTCTCAGAACTGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001286636
Insert Size 726 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286636.1
RefSeq Size 6931 bp
RefSeq ORF 726 bp
Locus ID 221477
UniProt ID Q6UWU4
Cytogenetics 6p21.2
Protein Families Transmembrane
MW 27.9 kDa
Gene Summary Exhibits histone deacetylase (HDAC) enhancer properties (PubMed:23460338). May play a role in cell cycle progression and wound repair of bronchial epithelial cells (PubMed:21857995).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) contains alternate 5' exon structure, resulting in differences in the 5' UTR and translation initiation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Both variants 3 and 4 encode isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.