beta V Tubulin (TUBB) (NM_001293213) Human Untagged Clone

CAT#: SC334761

TUBB (untagged) - Human tubulin, beta class I (TUBB), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TUBB
• Synonyms: CDCBM6; CSCSC1; M40; OK/SW-cl.56; TUBB1; TUBB5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334761 representing NM_001293213.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGGGAAATCGTGCACATCCAGGCTGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTG
  ATCAGTGATGAACATGGCATCGACCCCACCGGCACCTACCACGGGGACAGCGACCTGCAGCTGGACCGC
  ATCTCTGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCCATCCTGGTGGATCTAGAA
  CCTGGGACCATGGACTCTGTTCGCTCAGGTCCTTTTGGCCAGATCTTTAGACCAGACAACTTTGTATTT
  GGTCAGTCTGGGGCAGGTAACAACTGGGCCAAAGGCCACTACACAGAGGGCGCCGAGCTGGTTGATTCT
  GTCCTGGATGTGGTACGGAAGGAGGTCGATGAGCAGATGCTTAACGTGCAGAACAAGAACAGCAGCTAC
  TTTGTGGAATGGATCCCCAACAATGTCAAGACAGCCGTCTGTGACATCCCACCTCGTGGCCTCAAGATG
  GCAGTCACCTTCATTGGCAATAGCACAGCCATCCAGGAGCTCTTCAAGCGCATCTCGGAGCAGTTCACT
  GCCATGTTCCGCCGGAAGGCCTTCCTCCACTGGTACACAGGCGAGGGCATGGACGAGATGGAGTTCACC
  GAGGCTGAGAGCAACATGAACGACCTCGTCTCTGAGTATCAGCAGTACCAGGATGCCACCGCAGAAGAG
  GAGGAGGATTTCGGTGAGGAGGCCGAAGAGGAGGCCTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001293213
• Insert Size: 729 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001293213.1
• RefSeq Size: 2082 bp
• RefSeq ORF: 729 bp
• Locus ID: 203068
• UniProt ID: P07437
• Cytogenetics: 6p21.33
• Protein Families: Druggable Genome
• Protein Pathways: Gap junction, Pathogenic Escherichia coli infection
• MW: 27.3 kDa
• Gene Summary: This gene encodes a beta tubulin protein. This protein forms a dimer with alpha tubulin and acts as a structural component of microtubules. Mutations in this gene cause cortical dysplasia, complex, with other brain malformations 6. Alternative splicing results in multiple splice variants. There are multiple pseudogenes for this gene on chromosomes 1, 6, 7, 8, 9, and 13. [provided by RefSeq, Jun 2014]
  Transcript Variant: This variant (3) has multiple differences, compared to variant 1. It initiates translation at an alternate start codon and lacks an in-frame portion of the 3' coding region. The encoded isoform (c) has a distinct N-terminus and is shorter than isoform a.