PPCS (NM_001287511) Human Untagged Clone

CAT#: SC334785

PPCS (untagged) - Human phosphopantothenoylcysteine synthetase (PPCS), transcript variant 8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPCS
• Synonyms: CMD2C
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334785 representing NM_001287511.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGGAAATGGATCCGGTAGCCGAGTTCCCCCAGCCTCCCGGTGCTGCGCGCTGGGCTGAGGTTATG
  GCTCGCTTCGCGGCCAGGCTGGGCGCGCAGGGCCGGCGGGTGGTGTTGGTTACGTCAGGCGGCACCAAG
  GTCCCACTGGAAGCGCGGCCGGTGCGCTTCCTGGACAACTTCAGCAGCGGGCGGCGCGGTGCAACCTCG
  GCCGAGGCCTTCCTAGCCGCCGGCTACGGGGTCCTGTTCTTGTATCGCGCTCGCTCTGCCTTCCCCTAT
  GCCCACCGCTTCCCACCCCAGACTTGGCTGTCCGCTCTGCGGCCTTCGGGCCCAGCCCTTTCGGGCTTG
  CTGAGCCTGGAGGCCGAGGAGAATGCACTTCCGGGTTTTGCTGAGGCTCTGAGGAGCTACCAGGAGGCT
  GCGGCTGCAGGCACCTTCCTGGCAGTAGAGTTCACCACTTTGGCGGACTATTTGCATCTGTTGCAGGCT
  GCGGCCCAGGCACTCAATCCGCTAGGCCCTTCTGCGATGTTTTACCTGGCTGCGGCTGTGTCAGATTTC
  TATGTTCCTGTCTCTGAAATGCCTGAACACAAGATCCAGTCATCTGGGGGCCCACTGCAGGGAAAAGTT
  CAGTTAGAAGACATACTTCACCATCTTGAAAAAGAAGAAATCAATCCCCTTGCTACTACAGAAGAACAA
  CTCTGTTTGGTGCTTATTCCAGCCAGCACAGTGAAGACAGGCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001287511
• Insert Size: 735 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001287511.1
• RefSeq Size: 958 bp
• RefSeq ORF: 735 bp
• Locus ID: 79717
• UniProt ID: Q9HAB8
• Cytogenetics: 1p34.2
• Protein Pathways: Metabolic pathways, Pantothenate and CoA biosynthesis
• MW: 26.2 kDa
• Gene Summary: Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCS (EC 6.3.2.5), one of the last enzymes in this pathway, converts phosphopantothenate to phosphopantothenoylcysteine (Daugherty et al., 2002 [PubMed 11923312]).[supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (8) uses an alternate last exon compared to variant 1. The resulting isoform (d) has a shorter and distinct the C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.