CD300 (CD300LF) (NM_001289083) Human Untagged Clone

CAT#: SC334787

CD300LF (untagged) - Human CD300 molecule-like family member f (CD300LF), transcript variant 3


  "NM_001289083" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit polyclonal anti-CD300LF (CLM-1) antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "CD300LF"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD300LF
Synonyms CD300f; CLM-1; CLM1; IgSF13; IREM-1; IREM1; LMIR3; NKIR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334787 representing NM_001289083.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCCTGCTGACACTCTACCTGCTCCTCTTCTGGCTCTCAGGCTACTCCATTGTCACTCAAATCACC
GGTCCAACAACAGTGAATGGCTTGGAGCGGGGCTCCTTGACCGTGCAGTGTGTTTACAGATCAGGCTGG
GAGACCTACTTGAAGTGGTGGTGTCGAGGAGCTATTTGGCGTGACTGCAAGATCCTTGTTAAAACCAGT
GGGTCAGAGCAGGAGGTGAAGAGGGACCGGGTGTCCATCAAGGACAATCAGAAAAACCGCACGTTCACT
GTGACCATGGAGGATCTCATGAAAACTGATGCTGACACTTACTGGTGTGGAATTGAGAAAACTGGAAAT
GACCTTGGGGTCACAGTTCAAGTGACCATTGACCCAGCACCAGTCACCCAAGAAGAAACTAGCAGCTCC
CCAACTCTGACCGGCCACCACTTGGACAACAGGAGTGAGGGTTCCCAGGCTGCAAACTACAGACCTGCA
GCTCATCAGGCACAAGCTCCTGAAGCTCAGTGTCCTCCTGCCCCTCATCTTCACCATATTGCTGCTGCT
TTTGGTGGCCGCCTCACTCTTGGCTTGGAGGATGATGAAGTACCAGCAGAAAGCAGCCGGGATGTCCCC
AGAGCAGGTACTGCAGCCCCTGGAGGGCGACCTCTGCTATGCAGACCTGACCCTGCAGCTGGCCGGAAC
CTCCCCGCAAAAGGCTACCACGAAGCTTTCCTCTGCCCAGGTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001289083
Insert Size 735 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289083.1
RefSeq Size 1856 bp
RefSeq ORF 735 bp
Locus ID 146722
UniProt ID Q8TDQ1
Cytogenetics 17q25.1
Protein Families Druggable Genome, Transmembrane
MW 26.7 kDa
Gene Summary This gene encodes a member of the CD300 protein family. Members of this family are cell surface glycoproteins with a single IgV-like extracellular domain, and are involved in the regulation of immune response. The encoded protein is an inhibitory receptor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (3) includes an alternate exon in the central coding region, which results in a frameshift, compared to variant 1. The encoded isoform (3) has a shorter and distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations[BizGenius]

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.