ST3GAL6 (NM_001271142) Human Untagged Clone

CAT#: SC334788

ST3GAL6 (untagged) - Human ST3 beta-galactoside alpha-2,3-sialyltransferase 6 (ST3GAL6), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ST3GAL6
• Synonyms: SIAT10; ST3GALVI
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334788 representing NM_001271142.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGAACATCAGCGGAATATTTTCGACTTGCTCTTTCAAAACTGCAGAGTTGTGATCTCTTTGATGAG
  TTTGACAACATACCCTGTAAAAAGTGTGTGGTGGTTGGTAATGGAGGAGTTTTGAAGAATAAGACATTA
  GGAGAAAAAATCGACTCCTATGATGTAATAATAAGAATGAATAATGGTCCTGTTTTAGGACATGAAGAA
  GAAGTTGGGAGAAGGACAACCTTCCGACTTTTTTATCCAGAATCTGTTTTTTCAGATCCTATTCACAAT
  GACCCTAATACGACAGTGATTCTCACTGCTTTTAAGCCACATGATTTAAGGTGGCTGTTGGAATTGTTG
  ATGGGTGACAAAATAAACACTAATGGTTTTTGGAAGAAACCAGCCTTAAACCTGATTTATAAACCTTAT
  CAAATCCGAATATTAGATCCTTTCATTATCAGAACAGCAGCTTATGAACTGCTTCATTTTCCAAAAGTG
  TTTCCCAAAAATCAGAAACCTAAACACCCAACAACAGGAATTATTGCCATCACATTGGCGTTTTACATA
  TGTCACGAAGTTCACCTAGCTGGTTTTAAATACAACTTTTCTGACCTCAAGAGTCCTTTGCACTACTAT
  GGGAATGCCACCATGTCTTTGATGAATAAGAACGCGTATCACAATGTGACTGCAGAGCAGCTCTTTTTG
  AAGGACATTATAGAAAAAAACCTCGTAATCAACTTGACTCAAGATTGA
  AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
  ATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
  
• Restriction Sites: SgfI-RsrII Plasmid Map
• ACCN: NM_001271142
• Insert Size: 738 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271142.1
• RefSeq Size: 3458 bp
• RefSeq ORF: 738 bp
• Locus ID: 10402
• Cytogenetics: 3q12.1
• Protein Families: Transmembrane
• Protein Pathways: Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways
• MW: 28.2 kDa
• Gene Summary: The protein encoded by this gene is a member of the sialyltransferase family. Members of this family are enzymes that transfer sialic acid from the activated cytidine 5'-monophospho-N-acetylneuraminic acid to terminal positions on sialylated glycolipids (gangliosides) or to the N- or O-linked sugar chains of glycoproteins. This protein has high specificity for neolactotetraosylceramide and neolactohexaosylceramide as glycolipid substrates and may contribute to the formation of selectin ligands and sialyl Lewis X, a carbohydrate important for cell-to-cell recognition and a blood group antigen. [provided by RefSeq, Apr 2016]
  Transcript Variant: Variants 2, 10 and 11 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.