FDFT1 (NM_001287756) Human Untagged Clone

CAT#: SC334822

FDFT1 (untagged) - Human farnesyl-diphosphate farnesyltransferase 1 (FDFT1), transcript variant 11


  "NM_001287756" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
FDFT1 mouse monoclonal antibody, clone OTI2F10 (formerly 2F10)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "FDFT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FDFT1
Synonyms DGPT; ERG9; SQS; SQSD; SS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334822 representing NM_001287756.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTTGGCCACCCCGAAGAGTTCTACAACCTGGTGCGCTTCCGGATCGGGGGCAAGCGGAAGCCTCA
GAGTTTGAAGACCCCTTAGTTGGTGAAGATACAGAACGTGCCAACTCTATGGGCCTGTTTCTGCAGAAA
ACAAACATCATCCGTGACTATCTGGAAGACCAGCAAGGAGGAAGAGAGTTCTGGCCTCAAGAGGTTTGG
AGCAGGTATGTTAAGAAGTTAGGGGATTTTGCTAAGCCGGAGAATATTGACTTGGCCGTGCAGTGCCTG
AATGAACTTATAACCAATGCACTGCACCACATCCCAGATGTCATCACCTACCTTTCGAGACTCAGAAAC
CAGAGTGTGTTTAACTTCTGTGCTATTCCACAGGTGATGGCCATTGCCACTTTGGCTGCCTGTTATAAT
AACCAGCAGGTGTTCAAAGGGGCAGTGAAGATTCGGAAAGGGCAAGCAGTGACCCTGATGATGGATGCC
ACCAATATGCCAGCTGTCAAAGCCATCATATATCAGTATATGGAAGAGATTTATCATAGAATCCCCGAC
TCAGACCCATCTTCTAGCAAAACAAGGCAGATCATCTCCACCATCCGGACGCAGAATCTTCCCAACTGT
CAGCTGATTTCCCGAAGCCACTACTCCCCCATCTACCTGTCGTTTGTCATGCTTTTGGCTGCCCTGAGC
TGGCAGTACCTGACCACTCTCTCCCAGGTAACAGAAGACTATGTTCAGACTGGAGAACACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001287756
Insert Size 753 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287756.1
RefSeq Size 1705 bp
RefSeq ORF 753 bp
Locus ID 2222
UniProt ID P37268
Cytogenetics 8p23.1
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Steroid biosynthesis
MW 28.5 kDa
Gene Summary This gene encodes a membrane-associated enzyme located at a branch point in the mevalonate pathway. The encoded protein is the first specific enzyme in cholesterol biosynthesis, catalyzing the dimerization of two molecules of farnesyl diphosphate in a two-step reaction to form squalene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (11) differs at the 5' end, lacks several internal exons, uses alternate donor and acceptor splice sites, and initiates translation from an alternate start codon compared to variant 1. The resulting shorter isoform (5) has a distinct N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.