SYTL2 (NM_001289609) Human Untagged Clone

CAT#: SC334865

SYTL2 (untagged) - Human synaptotagmin-like 2 (SYTL2), transcript variant k

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SYTL2
• Synonyms: CHR11SYT; EXO4; PPP1R151; SGA72M; SLP2; SLP2A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334865 representing NM_001289609.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGGCAAGAAGAAAACACTCGTAGTGAAGAAAACCTTGAATCCTGTGTATAACGAAATACTGCGGTAT
  AAAATTGAAAAACAAATCTTAAAGACACAGAAATTGAACCTGTCCATTTGGCATCGGGATACATTTAAG
  CGCAATAGTTTCCTAGGGGAGGTGGAACTTGATTTGGAAACATGGGACTGGGATAACAAACAGAATAAA
  CAATTGAGATGGTACCCTCTGAAGCGGAAGACAGCACCAGTTGCCCTTGAAGCAGAAAACAGAGGTGAA
  ATGAAACTAGCTCTCCAGTATGTCCCAGAGCCAGTCCCTGGTAAAAAGCTTCCTACAACTGGAGAAGTG
  CACATCTGGGTGAAGGAATGCCTTGATCTACCACTGCTAAGGGGAAGTCATCTAAATTCTTTTGTTAAA
  TGTACCATCCTTCCAGATACAAGTAGGAAAAGTCGCCAGAAGACAAGAGCTGTAGGGAAAACCACCAAC
  CCTATCTTCAACCACACTATGGTGTATGATGGGTTCAGGCCTGAAGATCTGATGGAAGCCTGTGTAGAG
  CTTACTGTCTGGGACCATTACAAATTAACCAACCAATTTTTGGGAGGTCTTCGTATTGGCTTTGGAACA
  GGTAAAAGTTATGGGACTGAAGTGGACTGGATGGACTCTACTTCAGAGGAAGTTGCTCTCTGGGAGAAG
  ATGGTAAACTCCCCCAATACTTGGATTGAAGCAACACTGCCTCTCAGAATGCTTTTGATTGCCAAGATT
  TCCAAATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001289609
• Insert Size: 768 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001289609.1
• RefSeq Size: 2785 bp
• RefSeq ORF: 768 bp
• Locus ID: 54843
• UniProt ID: Q9HCH5
• Cytogenetics: 11q14.1
• MW: 29.6 kDa
• Gene Summary: The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jun 2009]
  Transcript Variant: This variant (k) lacks several 5' exons but contains alternate 5' exon structure, and it thus differs in its 5' UTR and initiates translation at an alternate start codon, compared to variant a. The encoded isoform (k) has a distinct and shorter N-terminus, compared to isoform a.