SYTL2 (NM_001289609) Human Untagged Clone

CAT#: SC334865

SYTL2 (untagged) - Human synaptotagmin-like 2 (SYTL2), transcript variant k


  "NM_001289609" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "SYTL2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SYTL2
Synonyms CHR11SYT; EXO4; PPP1R151; SGA72M; SLP2; SLP2A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334865 representing NM_001289609.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCAAGAAGAAAACACTCGTAGTGAAGAAAACCTTGAATCCTGTGTATAACGAAATACTGCGGTAT
AAAATTGAAAAACAAATCTTAAAGACACAGAAATTGAACCTGTCCATTTGGCATCGGGATACATTTAAG
CGCAATAGTTTCCTAGGGGAGGTGGAACTTGATTTGGAAACATGGGACTGGGATAACAAACAGAATAAA
CAATTGAGATGGTACCCTCTGAAGCGGAAGACAGCACCAGTTGCCCTTGAAGCAGAAAACAGAGGTGAA
ATGAAACTAGCTCTCCAGTATGTCCCAGAGCCAGTCCCTGGTAAAAAGCTTCCTACAACTGGAGAAGTG
CACATCTGGGTGAAGGAATGCCTTGATCTACCACTGCTAAGGGGAAGTCATCTAAATTCTTTTGTTAAA
TGTACCATCCTTCCAGATACAAGTAGGAAAAGTCGCCAGAAGACAAGAGCTGTAGGGAAAACCACCAAC
CCTATCTTCAACCACACTATGGTGTATGATGGGTTCAGGCCTGAAGATCTGATGGAAGCCTGTGTAGAG
CTTACTGTCTGGGACCATTACAAATTAACCAACCAATTTTTGGGAGGTCTTCGTATTGGCTTTGGAACA
GGTAAAAGTTATGGGACTGAAGTGGACTGGATGGACTCTACTTCAGAGGAAGTTGCTCTCTGGGAGAAG
ATGGTAAACTCCCCCAATACTTGGATTGAAGCAACACTGCCTCTCAGAATGCTTTTGATTGCCAAGATT
TCCAAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001289609
Insert Size 768 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289609.1
RefSeq Size 2785 bp
RefSeq ORF 768 bp
Locus ID 54843
UniProt ID Q9HCH5
Cytogenetics 11q14.1
MW 29.6 kDa
Gene Summary The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jun 2009]
Transcript Variant: This variant (k) lacks several 5' exons but contains alternate 5' exon structure, and it thus differs in its 5' UTR and initiates translation at an alternate start codon, compared to variant a. The encoded isoform (k) has a distinct and shorter N-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.