RNPS1 (NM_001286627) Human Untagged Clone

CAT#: SC334882

RNPS1 (untagged) - Human RNA binding protein S1, serine-rich domain (RNPS1), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RNPS1
• Synonyms: E5.1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334882 representing NM_001286627.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCTCCTTCACCTACCAAACGCAAAGACCGCTCAGATGAGAAGTCCAAGGATCGCTCAAAAGATAAA
  GGGGCCACCAAGGAGTCGAGTGAGAAGGATCGCGGCCGGGACAAAACCCGAAAGAGGCGCAGCGCTTCC
  AGTGGTAGCAGCAGTACCAGGTCTCGGTCCAGCTCGACTTCCAGCTCAGGCTCCAGCACCAGCACTGGC
  TCAAGCAGTGGCTCCAGCTCTTCCTCAGCATCCAGCCGCTCAGGAAGCTCCAGCACCTCCCGCAGCTCC
  AGCTCTAGCAGCTCTTCTGGCTCTCCAAGTCCTTCTCGGCGCAGACACGACAACAGGAGGCGCTCCCGC
  TCCAAATCCAAACCACCTAAAAGAGATGAAAAGGAGAGGAAAAGGCGGAGCCCATCTCCTAAGCCCACC
  AAAGTGCACATTGGGAGACTCACCCGGAATGTGACAAAGGATCACATCATGGAGATATTTTCCACCTAT
  GGGAAAATTAAAATGATTGACATGCCCGTGGAAAGGATGCATCCCCATCTGTCCAAAGGCTATGCGTAC
  GTAGAGTTTGAGAATCCAGATGAAGCCGAGAAGGCGCTGAAGCACATGGATGGAGGTCCCGCTCCCCGA
  GGCGCAGGTCCCCCGTGCGCCGGAGATCACGGTCCCCGGGCCGCCGCCGCCACAGGAGCCGCTCCAGCT
  CCAACTCCTCCCGATAAACAGGCCACTGAAGCTCTCGCCCCTGTAACTTATACCCCACCCAGCTCAGTT
  TTGTCACTTTTCTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001286627
• Insert Size: 774 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286627.1
• RefSeq Size: 1921 bp
• RefSeq ORF: 774 bp
• Locus ID: 10921
• UniProt ID: Q15287
• Cytogenetics: 16p13.3
• Protein Families: Transcription Factors
• MW: 27.4 kDa
• Gene Summary: This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. This protein contains many serine residues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
  Transcript Variant: This variant (5) lacks two alternate exons compared to variant 2. The resulting isoform (c) has shorter and distinct N- and C-termini compared to isoform a.