BPGM (NM_001293085) Human Untagged Clone

CAT#: SC334887

BPGM (untagged) - Human 2,3-bisphosphoglycerate mutase (BPGM), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BPGM
• Synonyms: DPGM; ECYT8
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334887 representing NM_001293085.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGTCCAAGTACAAACTTATTATGTTAAGACATGGAGAGGGTGCTTGGAATAAGGAGAACCGTTTTTGT
  AGCTGGGTGGATCAGAAACTCAACAGCGAAGGAATGGAGGAAGCTCGGAACTGTGGGAAGCAACTCAAA
  GCGTTAAACTTTGAGTTTGATCTTGTATTCACATCTGTCCTTAATCGGTCCATTCACACAGCCTGGCTG
  ATCCTGGAAGAGCTAGGCCAGGAATGGGTGCCTGTGGAAAGCTCCTGGCGTCTAAATGAGCGTCACTAT
  GGGGCCTTGATCGGTCTCAACAGGGAGCAGATGGCTTTGAATCATGGTGAAGAACAAGTGAGGCTCTGG
  AGAAGAAGCTACAATGTAACCCCGCCTCCCATTGAGGAGTCTCATCCTTACTACCAAGAAATCTACAAC
  GACCGGAGGTATAAAGTATGCGATGTGCCCTTGGATCAACTGCCACGGTCGGAAAGCTTAAAGGATGTT
  CTGGAGAGACTCCTTCCCTATTGGAATGAAAGGATTGCTCCCGAAGTATTACGTGGCAAAACCATTCTG
  ATATCTGCTCATGGAAATAGCAGTAGGGCACTCCTAAAACACCTGGAAGGTATCTCAGATGAAGACATC
  ATCAACATTACTCTTCCTACTGGAGTCCCCATTCTTCTGGAATTGGATGAAAACCTGCGTGCTGTTGGG
  CCTCATCAGTTCCTGGGTGACCAAGAGGCGATCCAAGCAGCCATTAAGAAAGTAGAAGATCAAGGAAAA
  GTGAAACAAGCTAAAAAATAG
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001293085
• Insert Size: 780 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001293085.1
• RefSeq Size: 1925 bp
• RefSeq ORF: 780 bp
• Locus ID: 669
• UniProt ID: P07738
• Cytogenetics: 7q33
• Protein Families: Druggable Genome
• Protein Pathways: Glycolysis / Gluconeogenesis, Metabolic pathways
• MW: 30 kDa
• Gene Summary: 2,3-diphosphoglycerate (2,3-DPG) is a small molecule found at high concentrations in red blood cells where it binds to and decreases the oxygen affinity of hemoglobin. This gene encodes a multifunctional enzyme that catalyzes 2,3-DPG synthesis via its synthetase activity, and 2,3-DPG degradation via its phosphatase activity. The enzyme also has phosphoglycerate phosphomutase activity. Deficiency of this enzyme increases the affinity of cells for oxygen. Mutations in this gene result in hemolytic anemia. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
  Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 2. Variants 1, 2, and 3 encode the same protein.