PRKACB (NM_001300915) Human Untagged Clone

CAT#: SC334916

PRKACB (untagged) - Human protein kinase, cAMP-dependent, catalytic, beta (PRKACB), transcript variant 10


  "NM_001300915" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit anti-PRKACB Polyclonal Antibody
    • 100 ul

USD 275.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "PRKACB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRKACB
Synonyms CAFD2; PKA C-beta; PKACB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334916 representing NM_001300915.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGTGCACGCAAATCATCAGATGCATCTGCTTGCTCCTCTTCAGAAATATCTGATTCCTTTGTGAAA
GAGTTTCTAGCCAAAGCCAAAGAAGACTTTTTGAAAAAATGGGAGAATCCAACTCAGAATAATGCCGGA
CTTGAAGATTTTGAAAGGAAAAAAACCCTTGGAACAGGTTCATTTGGAAGAGTCATGTTGGTAAAACAC
AAAGCCACTGAACAGTATTATGCCATGAAGATCTTAGATAAGCAGAAGGTTGTTAAACTGAAGCAAATA
GAGCATACTTTGAATGAGAAAAGAATATTACAGGCAGTGAATTTTCCTTTCCTTGTTCGACTGGAGTAT
GCTTTTAAGGATAATTCTAATTTATACATGGTTATGGAATATGTCCCTGGGGGTGAAATGTTTTCACAT
CTAAGAAGAATTGGAAGGTTCAGTGAGCCCCATGCACGGTTCTATGCAGCTCAGATAGTGCTAACATTC
GAGTACCTCCATTCACTAGACCTCATCTACAGAGATCTAAAACCTGAAAATCTCTTAATTGACCATCAA
GGCTATATCCAGGTCACAGACTTTGGGTTTGCCAAAAGAGTTAAAGGCAGAACTTGGACATTATGTGGA
ACTCCAGAGTATTTGGCTCCAGAAATAATTCTCAGCAAGGGCTACAATAAGGCAGTGGATTGGTGGGCA
TTAGGAGTGCTAATCTATGAAATGGCAGCTGGCTATCCCCCATTCTTTGCAGACCAACCAATTCAGATT
TATGAAAAGATTGTTTCTGGAAAGCAGAACTTTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001300915
Insert Size 795 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001300915.1
RefSeq Size 2156 bp
RefSeq ORF 795 bp
Locus ID 5567
UniProt ID P22694
Cytogenetics 1p31.1
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Apoptosis, Calcium signaling pathway, Chemokine signaling pathway, Dilated cardiomyopathy, Gap junction, GnRH signaling pathway, Hedgehog signaling pathway, Insulin signaling pathway, Long-term potentiation, MAPK signaling pathway, Melanogenesis, Olfactory transduction, Oocyte meiosis, Prion diseases, Progesterone-mediated oocyte maturation, Taste transduction, Vascular smooth muscle contraction, Vibrio cholerae infection, Wnt signaling pathway
MW 30.5 kDa
Gene Summary The protein encoded by this gene is a member of the serine/threonine protein kinase family. The encoded protein is a catalytic subunit of cAMP (cyclic AMP)-dependent protein kinase, which mediates signalling though cAMP. cAMP signaling is important to a number of processes, including cell proliferaton and differentiation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (10) differs in both the 5' and 3' exon structures, compared to variant 1. The encoded isoform (10) has distinct N- and C-termini and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.