SYT homolog 1 (SS18L1) (NM_001301778) Human Untagged Clone

CAT#: SC334921

SS18L1 (untagged) - Human synovial sarcoma translocation gene on chromosome 18-like 1 (SS18L1), transcript variant 2


  "NM_001301778" in other vectors (1)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "SS18L1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SS18L1
Synonyms CREST; LP2261
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301778, the custom clone sequence may differ by one or more nucleotides


ATGCAGCAGACGGCGCCTAACACGCTGCCCACCACCTCCATGAGCATCTCTGGGCCCGGCTACAGCCACG
CGGGACCCGCCTCGCAGGGCGTCCCCATGCAGGGGCAAGGCACCATCGGCAACTACGTGTCTCGGACCAA
CATCAACATGCAGTCCAACCCAGTCTCCATGATGCAGCAGCAGGCGGCCACGTCGCACTACAGCTCGGCG
CAGGGCGGCAGCCAGCACTACCAGGGCCAGTCGTCCATCGCCATGATGGGGCAGGGCAGCCAGGGGAGCA
GCATGATGGGGCAGCGGCCCATGGCGCCCTACCGGCCCTCCCAGCAAGGCTCTTCCCAGCAGTACCTGGG
CCAGGAGGAGTACTATGGCGAGCAGTACAGCCACAGCCAGGGCGCCGCGGAGCCCATGGGCCAGCAGTAC
TACCCCGACGGCCATGGCGATTACGCCTACCAGCAGTCATCCTACACGGAGCAGAGCTACGACCGGTCCT
TCGAGGAGTCCACGCAGCACTACTATGAGGGGGGAAACTCCCAGTACAGCCAGCAGCAGGCCGGGTACCA
GCAGGGTGCCGCGCAGCAGCAGACGTACTCCCAGCAGCAGTACCCCAGCCAGCAGAGCTACCCCGGGCAG
CAGCAGGGCTACGGGTCTGCCCAGGGAGCCCCGTCACAGTACCCCGGCTACCAGCAAGGCCAAGGCCAGC
AGTACGGAAGCTACCGAGCACCGCAGACAGCGCCGTCTGCCCAGCAGCAGCGGCCCTACGGCTATGAACA
GGGCCAGTATGGAAATTACCAGCAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001301778
ORF Size 798 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001301778.1, NP_001288707.1
RefSeq Size 4717
RefSeq ORF 798
Locus ID 26039
Gene Summary This gene encodes a calcium-responsive transactivator which is an essential subunit of a neuron-specific chromatin-remodeling complex. The structure of this gene is similar to that of the SS18 gene. Mutations in this gene are involved in amyotrophic lateral sclerosis (ALS). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (2) has an additional exon in the 5' region and an alternate splice acceptor site, which results in translation initiation at a downstream AUG start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.