ITM2C (NM_001287241) Human Untagged Clone

CAT#: SC334938

ITM2C (untagged) - Human integral membrane protein 2C (ITM2C), transcript variant 5


  "NM_001287241" in other vectors (1)

Reconstitution Protocol

USD 341.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ITM2C"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ITM2C
Synonyms BRI3; BRICD2C; E25; E25C; ITM3
Vector pCMV6-Entry
Sequence Data
>SC334938 representing NM_001287241.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGAAGATTAGCTTCCAGCCCGCCGTGGCTGGCATCAAGGGCGACAAGGCTGACAAGGCGTCGGCG
TCGGCCCCTGCGCCGGCCTCGGCCACCGAGATCCTGCTGACGCCGGCTAGGGAGGAGCAGCCCCCACAA
CATCGATCCAAGAGGGGGGGCTCAGTGGGCGGCGTGTGCTACCTGTCGATGGGCATGGTCGTGCTGCTC
ATGGGCCTCGTGTTCGCCTCTGTCTACATCTACAGATACTTCTTCCTTGCGCAGCTGGCCCGAGATAAC
TTCTTCCGCTGTGGTGTGCTGTATGAGGACTCCCTGTCCTCCCAGGTCCGGACTCAGATGGAGCTGGAA
GAGGATGTGAAAATCTACCTCGACGAGAACTACGAGCGCATCAACGTGCCTGTGCCCCAGTTTGGCGGC
GGTGACCCTGCAGACATCATCCATGACTTCCAGCGGGGTCTGACTGCGTACCATGATATCTCCCTGGAC
AAGTGCTATGTCATCGAACTCAACACCACCATTGTGCTGCCCCCTCGCAACTTCTGGGAGCTCCTCATG
AACGTGAAGAGGGGGACCTACCTGCCGCAGACGTACATCATCCAGGAGGAGATGGTGGTCACGGAGCAT
GTCAGTGACAAGGAGGCCCTGGGGTCCTTCATCTACCACCTGTGCAACGGGAAAGACACCTACCGGCTC
CGGCGCCGGGCAACGCGGAGGCGGATCAACAAGCGTGGGGCCAAGAACTGCAATGCCATCCGCCACTTC
GAGAACACCTTCGTGGTGGAGACGCTCATCTGCGGGGTGGTGTGA

Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001287241
Insert Size 804 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287241.1
RefSeq Size 2247 bp
RefSeq ORF 804 bp
Locus ID 81618
UniProt ID Q9NQX7
Cytogenetics 2q37.1
Protein Families Transmembrane
MW 30.2 kDa
Gene Summary Negative regulator of amyloid-beta peptide production. May inhibit the processing of APP by blocking its access to alpha- and beta-secretase. Binding to the beta-secretase-cleaved APP C-terminal fragment is negligible, suggesting that ITM2C is a poor gamma-secretase cleavage inhibitor. May play a role in TNF-induced cell death and neuronal differentiation (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) differs in the 5' UTR, compared to variant 1. Both variants 1 and 5 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.