RRP4 (EXOSC2) (NM_001282708) Human Untagged Clone

CAT#: SC334939

EXOSC2 (untagged) - Human exosome component 2 (EXOSC2), transcript variant 2


  "NM_001282708" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-EXOSC2 Antibody
    • 100 ul

USD 410.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "EXOSC2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EXOSC2
Synonyms hRrp4p; p7; RRP4; Rrp4p; SHRF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334939 representing NM_001282708.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGATGGAGATGAGGCTTCCAGTGGCTCGCAAGCCTCTTAGCGAGAGACTGGGCCGCGACACTAAG
AAACATCTAGTGGTGCCGGGGGATACAATCACTACGGACACAGGATTCATGCGGGGCCATGGAACGTAT
ATGGGAGAAGAGAAGCTCATTGCATCTGTTGCTGGCTCTGTGGAGAGAGTAAACAAGTTGATCTGTGTG
AAAGCTTTGAAAACCAGATACATTGGTGAAGTAGGAGACATCGTAGTGGGACGAATCACAGAGGTTCAA
CAGAAGAGGTGGAAGGTGGAGACCAACTCCAGGCTGGATTCGGTCTTGCTGCTCTCGTCCATGAACCTT
CCTGGAGGAGAGCTGAGGAGAAGATCTGCAGAAGATGAGCTTGCAATGAGAGGTTTCTTACAGGAAGGG
GACCTTATCAGTGGGGTTTTGGTCCAGGTTTCCCCCTCCCTGGTGAAACGGCAGAAGACCCACTTTCAT
GATTTGCCATGTGGTGCCTCAGTGATTCTCGGTAACAACGGCTTCATCTGGATTTACCCAACACCTGAG
CACAAAGAAGAGGAAGCAGGGGGCTTCATTGCAAACCTGGAGCCTGTCTCTCTTGCTGATCGAGAGGTG
ATATCCCGGCTTCGGAACTGCATCATCTCGCTGGTAACTCAGAGGATGATGCTGTATGATACCAGCATC
CTGTACTGCTATGAAGCATCCCTTCCACATCAGATCAAAGACATCTTAAAGCCAGAAATAATGGAGGAG
ATTGTGATGGAAACACGCCAGAGGCTTTTGGAACAGGAGGGATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001282708
Insert Size 804 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282708.1
RefSeq Size 1956 bp
RefSeq ORF 804 bp
Locus ID 23404
UniProt ID Q13868
Cytogenetics 9q34.12
Protein Pathways RNA degradation
MW 30 kDa
Gene Summary Non-catalytic component of the RNA exosome complex which has 3'->5' exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. In the nucleus, the RNA exosome complex is involved in proper maturation of stable RNA species such as rRNA, snRNA and snoRNA, in the elimination of RNA processing by-products and non-coding 'pervasive' transcripts, such as antisense RNA species and promoter-upstream transcripts (PROMPTs), and of mRNAs with processing defects, thereby limiting or excluding their export to the cytoplasm. The RNA exosome may be involved in Ig class switch recombination (CSR) and/or Ig variable region somatic hypermutation (SHM) by targeting AICDA deamination activity to transcribed dsDNA substrates. In the cytoplasm, the RNA exosome complex is involved in general mRNA turnover and specifically degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3' untranslated regions, and in RNA surveillance pathways, preventing translation of aberrant mRNAs. It seems to be involved in degradation of histone mRNA. The catalytic inactive RNA exosome core complex of 9 subunits (Exo-9) is proposed to play a pivotal role in the binding and presentation of RNA for ribonucleolysis, and to serve as a scaffold for the association with catalytic subunits and accessory proteins or complexes. EXOSC2 as peripheral part of the Exo-9 complex stabilizes the hexameric ring of RNase PH-domain subunits through contacts with EXOSC4 and EXOSC7.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region compared to variant 1. It encodes isoform 2 which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.