C22orf25 (TANGO2) (NM_001283116) Human Untagged Clone

CAT#: SC334992

TANGO2 (untagged) - Human transport and golgi organization 2 homolog (Drosophila) (TANGO2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TANGO2
• Synonyms: C22orf25; MECRCN
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334992 representing NM_001283116.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGTGCATCATCTTCTTTAAGTTTGATCCTCGCCCTGTTTCCAAAAACGCGTACAGGCTCATCTTGGCA
  GCCAACAGGGATGAATTCTACAGCCGACCCTCCAAGTTAGCTGACTTCTGGGGGAACAACAACGAGATC
  CTCAGTGGGCTGGACATGGAGGAAGGCAAGGAAGGAGGCACATGGCTGGGCATCAGCACACGTGGCAAG
  CTGGCAGCACTCACCAACTACCTGCAGCCGCAGCTGGACTGGCAGGCCCGAGGGCGAGGTGAACTTGTC
  ACCCACTTTCTGACCACTGACGTGGACAGCTTGTCCTACCTGAAGAAGGTCTCTATGGAGGGCCATCTG
  TACAATGGCTTCAACCTCATAGCAGCCGACCTGAGCACAGCAAAGGGAGACGTCATTTGCTACTATGGG
  AACCGAGGGGAGCCTGATCCTATCGTTTTGACGCCAGGCACCTACGGGCTGAGCAACGCGCTGCTGGAG
  ACTCCCTGGAGGAAGCTGTGCTTTGGGAAGCAGCTCTTCCTGGAGGCTGTGGAACGGAGCCAGGCGCTG
  CCCAAGGATGTGCTCATCGCCAGCCTCCTGGATGTGCTCAACAATGAAGAGGCGCAGCTGCCAGACCCG
  GCCATCGAGGACCAGGGTGGGGAGTACGTGCAGCCCATGCTGAGCAAGTACGCGGCTGTGTGCGTGCGC
  TGCCCTGGCTACGGCACCAGAACCAACACTATCATCCTGGTAGATGCGGACGGCCACGTGACCTTCACT
  GAGCGTAGCATGATGGACAAGGACCTCTCCCACTGGGAGACCAGAACCTATGAGTTCACACTGCAGAGC
  TAA
  
• Restriction Sites: SgfI-RsrII Plasmid Map
• ACCN: NM_001283116
• Insert Size: 831 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001283116.1
• RefSeq Size: 2217 bp
• RefSeq ORF: 831 bp
• Locus ID: 128989
• UniProt ID: Q6ICL3
• Cytogenetics: 22q11.21
• MW: 30.9 kDa
• Gene Summary: This gene belongs to the transport and Golgi organization family, whose members are predicted to play roles in secretory protein loading in the endoplasmic reticulum. Depletion of this gene in Drosophila S2 cells causes fusion of the Golgi with the ER. In mouse tissue culture cells, this protein co-localizes with a mitochondrially targeted mCherry protein and displays very low levels of co-localization with Golgi and peroxisomes. Allelic variants of this gene are associated with rhabdomyolysis, metabolic crises with encephalopathy, and cardiac arrhythmia. [provided by RefSeq, Apr 2016]