CDKL1 (NM_001282236) Human Untagged Clone

CAT#: SC334996

CDKL1 (untagged) - Human cyclin-dependent kinase-like 1 (CDC2-related kinase) (CDKL1), transcript variant 2


  "NM_001282236" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
CDKL1 mouse monoclonal antibody, clone OTI1D9 (formerly 1D9)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "CDKL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CDKL1
Synonyms KKIALRE; P42
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334996 representing NM_001282236.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGGAGAAGTATGAAAAAATTGGGAAAATTGGAGAAGGATCCTATGGAGTTGTTTTCAAATGTAGA
AACAGGGACACGGGTCAGATTGTGGCCATCAAGAAGTTTCTGGAATCAGAAGATGACCCTGTCATAAAG
AAAATTGCCCTTCGGGAAATCCGAATGCTCAAGCAACTCAAGCATCCCAACCTTGTTAACCTCCTGGAA
GTCTTCAGGAGGAAACGGAGGCTTCACCTGGTGTTTGAATATTGTGACCACACAGTTCTCCATGAGTTG
GACAGATACCAAAGAGGGGTACCAGAACATCTCGTGAAGAGCATAACTTGGCAGACACTGCAAGCTGTA
AATTTTTGCCATAAACACAATTGCATACATAGAGACGTGAAGCCAGAAAATATCCTCATCACGAAACAT
TCCGTGATTAAGCTTTGTGACTTTGGATTTGCTCGGCTTTTGACTGGACCGAGTGACTACTATACAGAC
TACGTGGCTACCAGGTGGTACCGCTCCCCTGAGCTGCTGGTGGGGGACACGCAGTACGGCCCCCCGGTG
GATGTTTGGGCAATTGGCTGTGTCTTTGCTGAGCTGCTGTCAGGAGTGCCTCTGTGGCCAGGAAAATCG
GATGTGGATCAGCTGTATCTGATTAGGAAGACCTTGGGGGATCTCATTCCTAGGCACCAGCAAGTGTTT
AGCACGAATCAGTACTTCAGTGGAGTGAAAATTCCAGACCCTGAAGATATGGAACCACTTGAATTAAAA
TTCCCAAACATCTCTTATCCTGCCCTGGGGCTCCTAAAGGGCAGAGTACCAATTGCTTCAAGAACAGAA
TAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001282236
Insert Size 831 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282236.1
RefSeq Size 2217 bp
RefSeq ORF 831 bp
Locus ID 8814
Cytogenetics 14q21.3
Protein Families Druggable Genome, Protein Kinase
MW 31.9 kDa
Gene Summary This gene product is a member of a large family of CDC2-related serine/threonine protein kinases that accumulates primarily in the nucleus. [provided by RefSeq, Nov 2018]
Transcript Variant: This variant (2) differs in the 5' UTR, 3' UTR, and 3' coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.