NMNAT1 (NM_001297778) Human Untagged Clone

CAT#: SC335019

NMNAT1 (untagged) - Human nicotinamide nucleotide adenylyltransferase 1 (NMNAT1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NMNAT1
• Synonyms: LCA9; NMNAT; PNAT1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001297778, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAAATTCCGAGAAGACTGAAGTGGTTCTCCTTGCTTGTGGTTCATTCAATCCCATCACCAACATGC
  ACCTCAGGTTGTTTGAGCTGGCCAAGGACTACATGAATGGAACAGGAAGGTACACAGTTGTCAAAGGCAT
  CATCTCTCCTGTTGGTGATGCCTACAAGAAGAAAGGACTCATTCCTGCCTATCACCGGGTCATCATGGCA
  GAACTTGCTACCAAGAATTCTAAATGGGTGGAAGTTGATACATGGGAAAGTCTTCAGAAGGAGTGGAAAG
  AGACTCTGAAGGTGCTAAGACACCATCAAGAGAAATTGGAGGCTAGTGACTGTGATCACCAGCAGAACTC
  ACCTACTCTAGAAAGGCCTGGAAGGAAGAGGAAGTGGACTGAAACACAAGATTCTAGTCAAAAGAAATCC
  CTAGAGCCAAAAACAAAAGCTGTGCCAAAGGTCAAGCTGCTGTGTGGGGCAGATTTATTGGAGTCCTTTG
  CTGTTCCCAATTTGTGGAAGAGTGAAGACATCACCCAAATCGTGGCCAACTATGGGCTCATATGTGTTAC
  TCGGGCTGGAAATGATGCTCAGAAGTTTATCTATGAATCGGATGTGCTGTGGAAACACCGGAGCAACATT
  CACGTGGTGAATGAATGGATCGCTAATGACATCTCATCCACAAAAATCCGGAGAGCCCTCAGAAGGGGCC
  AGAGCATTCGCTACTTGGTACCAGATCTTGTCCAAGAATACATTGAAAAGCATAATTTGTACAGCTCTGA
  GAGTGAAGACAGGAATGCTGGGGTCATCCTGGCCCCTTTGCAGAGAAACACTGCAGAAGCTAAGACATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001297778
• ORF Size: 840 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001297778.1, NP_001284707.1
• RefSeq Size: 3796
• RefSeq ORF: 840
• Locus ID: 64802
• Protein Pathways: Metabolic pathways, Nicotinate and nicotinamide metabolism
• Gene Summary: This gene encodes an enzyme which catalyzes a key step in the biosynthesis of nicotinamide adenine dinucleotide (NAD). The encoded enzyme is one of several nicotinamide nucleotide adenylyltransferases, and is specifically localized to the cell nucleus. Activity of this protein leads to the activation of a nuclear deacetylase that functions in the protection of damaged neurons. Mutations in this gene have been associated with Leber congenital amaurosis 9. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are located on chromosomes 1, 3, 4, 14, and 15. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.