UGT2B10 (NM_001290091) Human Untagged Clone

CAT#: SC335030

UGT2B10 (untagged) - Human UDP glucuronosyltransferase 2 family, polypeptide B10 (UGT2B10), transcript variant 3


  "NM_001290091" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "UGT2B10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UGT2B10
Synonyms UDPGT2B10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335030 representing NM_001290091.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGGAAAGCTGACATATGGCTTATGCGAAACTCCTGGAATTTTAAATTTCCTCATCCATTCTTACCA
AATGTTGATTTTGTTGGAGGACTCCACTGCAAACCTGCCAAACCCCTACCTAAGGAAATGGAGGAGTTT
GTACAGAGCTCTGGAGAAAATGGTGTTGTGGTGTTTTCTCTGGGGTCAATGGTCAGTAACATGACAGAA
GAAAGGGCCAACGTAATTGCAACAGCCCTTGCCAAGATCCCACAAAAGGTTCTTTGGAGATTTGATGGG
AATAAACCAGATGCCTTAGGTCTCAATACTCGACTGTACAAGTGGATACCCCAGAATGACCTTCTAGGT
CATCCAAAAACCAGAGCTTTTATAACTCATGGTGGAGCCAATGGCATCTATGAGGCAATCTACCATGGG
ATCCCTATGGTGGGCATTCCATTGTTTTTTGATCAACCTGATAATATTGCTCACATGAAGGCCAAGGGA
GCAGCTGTTAGAGTGGACTTCAACACAATGTCGAGTACAGACCTGCTGAATGCACTGAAGACAGTAATT
AATGATCCTTCATATAAAGAGAATATTATGAAATTATCAAGAATTCAACATGATCAACCAGTGAAGCCC
CTGGATCGAGCAGTCTTCTGGATTGAATTTGTCATGCGCCACAAAGGAGCCAAACATCTTCGAGTTGCA
GCCCACAACCTCACCTGGTTCCAGTACCACTCTTTGGATGTGATTGGGTTCCTGCTGGCTTGTGTGGCA
ACCGTGCTATTTATCATCACAAAGTGTTGTCTGTTTTGTTTCTGGAAGTTTGCTAGAAAAGGAAAGAAG
GGAAAAAGGGATTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001290091
Insert Size 843 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290091.1
RefSeq Size 2187 bp
RefSeq ORF 843 bp
Locus ID 7365
UniProt ID P36537
Cytogenetics 4q13.2
Protein Families Transmembrane
Protein Pathways Androgen and estrogen metabolism, Ascorbate and aldarate metabolism, Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Pentose and glucuronate interconversions, Porphyrin and chlorophyll metabolism, Retinol metabolism, Starch and sucrose metabolism
MW 31.8 kDa
Gene Summary UDPGT is of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.