DACT2 (NM_001286351) Human Untagged Clone

CAT#: SC335037

DACT2 (untagged) - Human dishevelled-binding antagonist of beta-catenin 2 (DACT2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DACT2
• Synonyms: bA503C24.7; C6orf116; DAPPER2; DPR2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335037 representing NM_001286351.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTGGACGCCGGGCGGACCCCCGGGGTCCGCGGGCTGGGACCGCCGTAGGTTGGGCGCGAGGTTGCGC
  GCGGCGTTCGCGGGGCTGCAGGAGCTGCAGGGGCTGCGAGCCACGCAGCAGGAGCGGGTACGGGGCGCC
  CTGGCCCTGCAGCCCCCGCCCGCGCCCGCCGCGCCCTGCGGCCCCCACGGCCTCCACGGCCCCGAGCAG
  CAGCTGGAGGCGGCGCTGGCCGCGCTGCAGGAGCAGCTGTCCCGGCTGAGACAACAGGACATCGGCCTG
  AAGACCCACCTGGACCAGCTGGACCTGCAGATTAGCAAGCTGCAGCTGGATGTGGGCACAGCCTCAGGG
  GAGGCCCTGGACAGCGACAGCAGGCCCAGCTCAGGCTTTTACGAGATGAGCGACGGTGGATCCTGCTCC
  CTGTCCACGTCCTGTGCCTCCGTCTGCAGTGACCACATCTCTCCCTCGCTGGGCAGTTTGTTGCCTGTG
  GCCCAGGCCCACAAGGCCAGGCCCAGCATGGGGGACTGGAGGCCCCGGTCGGTTGATGAGACTACTGTG
  CCAGCGTGGAGACCCCAGGCTACCGAGGAGGGCGCCAGGCCCCCAGGGAGCGTGGAGGATGCAGGCCAG
  CCGTGGGGCACATTCTGGCCCAGGCCTGTGTCTACAGAGCTGTGCAATGCTCCAGGTGAACTTGACATG
  CATGCTCCGCCTGCAGGCTGCACCTCCAGTTCACTGACAGGTGTAGGTTCTGGTTTGAGAGGAAAGTGT
  GGCCTCTGTGGCTGTCAGCTCCCTTTCTGCTCAGTGAACACAAGTTCAAAGACAAAATCATCAGGAATT
  TCAAGACAGCAATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001286351
• Insert Size: 843 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286351.1
• RefSeq Size: 2043 bp
• RefSeq ORF: 843 bp
• Locus ID: 168002
• UniProt ID: Q5SW24
• Cytogenetics: 6q27
• MW: 29.3 kDa
• Gene Summary: Involved in regulation of intracellular signaling pathways during development. Negatively regulates the Nodal signaling pathway, possibly by promoting the lysosomal degradation of Nodal receptors, such as TGFBR1. May be involved in control of the morphogenetic behavior of kidney ureteric bud cells by keeping cells epithelial and restraining their mesenchymal character. May play an inhibitory role in the re-epithelialization of skin wounds by attenuating TGF-beta signaling (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) contains alternate 3' exon structure and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (c) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.