HAGHL (NM_001290137) Human Untagged Clone

CAT#: SC335047

HAGHL (untagged) - Human hydroxyacylglutathione hydrolase-like (HAGHL), transcript variant 3


  "NM_001290137" in other vectors (1)

Reconstitution Protocol

USD 341.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
HAGHL mouse monoclonal antibody, clone OTI3H2 (formerly 3H2)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "HAGHL"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HAGHL
Vector pCMV6-Entry
Sequence Data
>SC335047 representing NM_001290137.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGGTCAAGGTCATCCCCGTGCTCGAGGACAACTACATGTACCTGGTCATCGAGGAGCTCACGCGC
GAGGCGGTGGCCGTGGACGTGGCTGTGCCCAAGAGGCTGCTGGAGATCGTGGGCCGGGAGGGGGTGTCT
CTGACCGCTGTGCTGACCACCCACCATCACTGGGACCACGCGCGGGGAAACCCGGAGCTGGCGCGGCTT
CGTCCCGGGCTGGCGGTGCTGGGCGCGGACGAGCGCATCTTCTCGCTGACGCGCAGGCTGGCGCACGGC
GAGGAGCTGCGGTTCGGGGCCATCCACGTGCGTTGCCTCCTGACGCCCGGCCACACCGCCGGCCACATG
AGCTACTTCCTGTGGGAGGACGATTGCCCGGACCCACCCGCCCTGTTCTCGGGCGACGCGCTGTCGGTG
GCCGGCTGCGGCTCGTGCCTGGAGGGCAGCGCCCAGCAGATGTACCAGAGCCTGGCCGAGCTGGGTACC
CTGCCCCCCGAGACGAAGGTGTTCTGCGGCCACGAGCACACGCTTAGCAACCTGGAGTTTGCCCAGAAA
GTGGAGCCCTGCAACGACCACGTGAGAGCCAAGCTGTCCTGGGCTAAGAAGAGGGATGAGGATGACGTG
CCCACTGTGCCGTCGACTCTGGGCGAGGAGCGCCTCTACAACCCCTTCCTGCGGGTGGCAGAGGAGCCG
GTGCGCAAGTTCACGGGCAAGGCGGTCCCCGCCGACGTCCTGGAGGCGCTATGCAAGGAGCGGGCGCGC
TTCGAACAGGCGGGCGAGCCGCGGCAGCCACAGGCGCGGGCCCTCCTTGCGCTGCAGTGGGGGCTCCTG
AGTGCAGCCCCACACGACTGA

Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001290137
Insert Size 849 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290137.1
RefSeq Size 1355 bp
RefSeq ORF 849 bp
Locus ID 84264
UniProt ID Q6PII5
Cytogenetics 16p13.3
Protein Pathways Pyruvate metabolism
MW 31.2 kDa
Gene Summary Hydrolase acting on ester bonds.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.