Lysosomal acid lipase (LIPA) (NM_001288979) Human Untagged Clone

CAT#: SC335055

LIPA (untagged) - Human lipase A, lysosomal acid, cholesterol esterase (LIPA), transcript variant 3


  "NM_001288979" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Lipase A Antibody
    • 100 ul

USD 424.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "LIPA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LIPA
Synonyms CESD; LAL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335055 representing NM_001288979.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCAACAGCAGAGGAAATACCTGGTCTCGGAAACATAAGACACTCTCAGTTTCTCAGGATGAATTC
TGGGCTTTCAGTTATGATGAGATGGCAAAATATGACCTACCAGCTTCCATTAACTTCATTCTGAATAAA
ACTGGCCAAGAACAAGTGTATTATGTGGGTCATTCTCAAGGCACCACTATAGGTTTTATAGCATTTTCA
CAGATCCCTGAGCTGGCTAAAAGGATTAAAATGTTTTTTGCCCTGGGTCCTGTGGCTTCCGTCGCCTTC
TGTACTAGCCCTATGGCCAAATTAGGACGATTACCAGATCATCTCATTAAGGACTTATTTGGAGACAAA
GAATTTCTTCCCCAGAGTGCGTTTTTGAAGTGGCTGGGTACCCACGTTTGCACTCATGTCATACTGAAG
GAGCTCTGTGGAAATCTCTGTTTTCTTCTGTGTGGATTTAATGAGAGAAATTTAAATATGTCTAGAGTG
GATGTATATACAACACATTCTCCTGCTGGAACTTCTGTGCAAAACATGTTACACTGGAGCCAGGCTGTT
AAATTCCAAAAGTTTCAAGCCTTTGACTGGGGAAGCAGTGCCAAGAATTATTTTCATTACAACCAGAGT
TATCCTCCCACATACAATGTGAAGGACATGCTTGTGCCGACTGCAGTCTGGAGCGGGGGTCACGACTGG
CTTGCAGATGTCTACGACGTCAATATCTTACTGACTCAGATCACCAACTTGGTGTTCCATGAGAGCATT
CCGGAATGGGAGCATCTTGACTTCATTTGGGGCCTGGATGCCCCTTGGAGGCTTTATAATAAAATTATT
AATCTAATGAGGAAATATCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001288979
Insert Size 852 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001288979.1
RefSeq Size 2545 bp
RefSeq ORF 852 bp
Locus ID 3988
UniProt ID P38571
Cytogenetics 10q23.31
Protein Families Druggable Genome
Protein Pathways Lysosome, Steroid biosynthesis
MW 32.6 kDa
Gene Summary This gene encodes lipase A, the lysosomal acid lipase (also known as cholesterol ester hydrolase). This enzyme functions in the lysosome to catalyze the hydrolysis of cholesteryl esters and triglycerides. Mutations in this gene can result in Wolman disease and cholesteryl ester storage disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (3) lacks two consecutive exons in the 5' region, which results in translation initiation at a downstream AUG, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.