HEXIM2 (NM_001303441) Human Untagged Clone

CAT#: SC335091

HEXIM2 (untagged) - Human hexamethylene bis-acetamide inducible 2 (HEXIM2), transcript variant 7


  "NM_001303441" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-HEXIM2 Antibody
    • 100 ul

USD 475.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "HEXIM2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HEXIM2
Synonyms L3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335091 representing NM_001303441.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGGCCACTCCGAACCAGACCGCCTGTAATGCAGAGTCACCAGTGGCCCTGGAGGAGGCCAAGACC
TCTGGTGCCCCGGGGAGCCCCCAAACACCCCCTGAGCGTCATGACTCTGGTGGTTCCCTGCCCCTGACA
CCGCGGATGGAGAGCCACTCAGAGGATGAAGATCTTGCTGGGGCTGTCGGTGGCCTGGGCTGGAACAGT
AGGAGTCCCCGGACCCAGAGCCCAGGGGGCTGCTCAGCGGAGGCTGTGCTGGCCCGGAAGAAACACCGT
CGGCGGCCATCGAAGCGCAAAAGGCACTGGCGACCCTACCTGGAGCTGAGCTGGGCTGAGAAACAACAG
CGGGATGAGAGGCAGAGCCAGAGGGCCTCCCGGGTCCGCGAAGAGATGTTCGCCAAAGGCCAGCCCGTG
GCCCCCTACAACACCACCCAGTTCCTGATGAATGACAGGGACCCGGAGGAGCCCAACTTGGATGTGCCC
CATGGGATCTCCCACCCAGGTTCCAGTGGGGAGAGTGAGGCCGGGGACAGTGATGGGCGGGGCCGAGCG
CACGGTGAGTTCCAGCGGAAGGACTTCTCTGAGACTTACGAACGCTTCCACACCGAGAGCCTGCAGGGC
CGCAGCAAGCAGGAGCTGGTGCGAGACTACCTGGAGCTGGAGAAGCGGCTGTCGCAGGCGGAGGAGGAG
ACTAGGAGGCTGCAGCAGCTGCAGGCGTGCACCGGCCAGCAGTCCTGCCGCCAGGTGGAGGAGCTGGCT
GCCGAGGTCCAGAGGCTCCGGACCGAAAACCAGCGGCTTCGTCAGGAGAACCAGATGTGGAACCGAGAG
GGCTGCCGCTGTGATGAGGAGCCGGGTACCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001303441
Insert Size 861 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001303441.1
RefSeq Size 1488 bp
RefSeq ORF 861 bp
Locus ID 124790
UniProt ID Q96MH2
Cytogenetics 17q21.31
Protein Families Transcription Factors
MW 32.4 kDa
Gene Summary This gene encodes a member of the HEXIM family of proteins. This protein is a component of the 7SK small nuclear ribonucleoprotein. This protein has been found to negatively regulate the kinase activity of the cyclin-dependent kinase P-TEFb, which phosphorylates multiple target proteins to promote transcriptional elongation. This gene is located approximately 7 kb downstream from related family member HEXIM1 on chromosome 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Transcript Variant: This variant (7) differs in the 5' UTR compared to variant 1. Variants 1-9 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.