NANOG (NM_001297698) Human Untagged Clone

CAT#: SC335117

NANOG (untagged) - Human Nanog homeobox (NANOG), transcript variant 2


  "NM_001297698" in other vectors (1)

Reconstitution Protocol

USD 477.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Antibody against NANOG (N-term)
    • 100 ug

USD 450.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "NANOG"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NANOG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335117 representing NM_001297698.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGTGTGGATCCAGCTTGTCCCCAAAGCTTGCCTTGCTTTGAAGCATCCGACTGTAAAGAATCTTCA
CCTATGCCTGTGATTTGTGGGCCTGAAGAAAACTATCCATCCTTGCAAATGTCTTCTGCTGAGATGCCT
CACACGGAGACTGTCTCTCCTCTTCCTTCCTCCATGGATCTGCTTATTCAGGACAGCCCTGATTCTTCC
ACCAGTCCCAAAGGCAAACAACCCACTTCTGCAGAGAAGAGTGTCGCAAAAAAGGAAGACAAGGTCCCG
GTCAAGAAACAGAAGACCAGAACTGTGTTCTCTTCCACCCAGCTGTGTGTACTCAATGATAGATTTCAG
AGACAGAAATACCTCAGCCTCCAGCAGATGCAAGAACTCTCCAACATCCTGAACCTCAGCTACAAACAG
GTGAAGACCTGGTTCCAGAACCAGAGAATGAAATCTAAGAGGTGGCAGAAAAACAACTGGCCGAAGAAT
AGCAATGGTGTGACGCAGGGATGCCTGGTGAACCCGACTGGGAACCTTCCAATGTGGAGCAACCAGACC
TGGAACAATTCAACCTGGAGCAACCAGACCCAGAACATCCAGTCCTGGAGCAACCACTCCTGGAACACT
CAGACCTGGTGCACCCAATCCTGGAACAATCAGGCCTGGAACAGTCCCTTCTATAACTGTGGAGAGGAA
TCTCTGCAGTCCTGCATGCAGTTCCAGCCAAATTCTCCTGCCAGTGACTTGGAGGCTGCCTTGGAAGCT
GCTGGGGAAGGCCTTAATGTAATACAGCAGACCACTAGGTATTTTAGTACTCCACAAACCATGGATTTA
TTCCTAAACTACTCCATGAACATGCAACCTGAAGACGTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001297698
Insert Size 870 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001297698.1
RefSeq Size 2055 bp
RefSeq ORF 870 bp
Locus ID 79923
UniProt ID Q9H9S0
Cytogenetics 12p13.31
Protein Families Cancer stem cells, Embryonic stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Stem cell - Pluripotency
MW 32.8 kDa
Gene Summary The protein encoded by this gene is a DNA binding homeobox transcription factor involved in embryonic stem (ES) cell proliferation, renewal, and pluripotency. The encoded protein can block ES cell differentiation and can also autorepress its own expression in differentiating cells. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.