LMCD1 (NM_001278233) Human Untagged Clone

CAT#: SC335130

LMCD1 (untagged) - Human LIM and cysteine-rich domains 1 (LMCD1), transcript variant 2


  "NM_001278233" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
LMCD1 mouse monoclonal antibody, clone OTI1H5 (formerly 1H5)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "LMCD1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LMCD1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335130 representing NM_001278233.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACTCCAAGTATTCCACCCTCACTGCTCGGGTGAAAGGCGGGGACGGCATCCGGATTTACAAGAGG
AACCGGATGATCATGACCAACCCTATTGCTACTGGGAAAGATCCCACTTTTGACACCATCACCTACGAG
TGGGCTCCCCCTGGAGTCACCCAGAAACTGGGACTGCAGTACATGGAGCTCATCCCCAAGGAGAAGCAG
CCAGTGACAGGCACAGAGGGTGCCTTTTACCGCCGCCGCCAGCTCATGCACCAGCTCCCCATCTATGAC
CAGGATCCCTCGCGCTGCCGTGGACTTTTGGAGAATGAGTTGAAACTGATGGAAGAATTTGTCAAGCAA
TATAAGAGCGAGGCCCTCGGCGTGGGAGAAGTGGCCCTCCCGGGGCAGGGTGGCTTGCCCAAGGAGGAG
GGGAAGCAGCAGGAAAAGCCAGAGGGGGCAGAGACCACTGCTGCTACCACCAACGGCAGTCTCAGTGAC
CCGTCCAAAGAAGTGGAATACGTCTGCGAGCTCTGCAAGGGAGCGGCCCCTCCTGACAGCCCCGTGGTC
TACTCGGACAGGGCAGGCTACAACAAGCAGTGGCACCCCACCTGCTTTGTGTGTGCCAAGTGCTCCGAG
CCGCTGGTGGACCTCATCTACTTCTGGAAGGATGGTGCACCCTGGTGCGGCCGCCATTACTGCGAGAGT
CTGCGGCCCCGGTGCTCCGGCTGCGATGAGATAATATTCGCTGAGGACTACCAGCGTGTGGAAGATCTG
GCCTGGCACCGAAAGCACTTTGTCTGTGAGGGTTGTGAGCAGCTGCTGAGCGGCCGGGCGTACATCGTC
ACCAAGGGTCAGCTTCTGTGCCCAACTTGCAGCAAGTCCAAACGCTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001278233
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278233.1
RefSeq Size 1668 bp
RefSeq ORF 879 bp
Locus ID 29995
UniProt ID Q9NZU5
Cytogenetics 3p25.3
MW 32.9 kDa
Gene Summary This gene encodes a member of the LIM-domain family of zinc finger proteins. The encoded protein contains an N-terminal cysteine-rich domain and two C-terminal LIM domains. The presence of LIM domains suggests involvement in protein-protein interactions. The protein may act as a co-regulator of transcription along with other transcription factors. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Transcript Variant: This variant (2) lacks an alternate exon in the 5' coding region and uses a downstream start codon compared to variant 1. The encoded isoform (2) is shorter at the N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.