CYP39A1 (NM_001278739) Human Untagged Clone

CAT#: SC335167

CYP39A1 (untagged) - Human cytochrome P450, family 39, subfamily A, polypeptide 1 (CYP39A1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CYP39A1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001278739, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTCTTTAATAAAAGTTTGTTTTCCACAAACAAGAAAAAAATCAAGGAGTTCCATCAGTATTTTCAAG
  TTTATGATGAAGATTTTGAGTATGGGTCCCAGTTGCCAGAGTGTCTTCTAAGAAACTGGTCAAAATCCAA
  AAAGTGGTTCCTGGAACTGTTTGAGAAAAACATTCCAGATATAAAAGCATGTAAATCTGCAAAAGATAAT
  TCCATGACATTATTGCAAGCTACGCTGGATATTGTAGAGACGGAAACAAGTAAGGAAAACTCACCCAATT
  ATGGGCTCTTACTGCTTTGGGCTTCTCTGTCTAATGCTGTTCCTGTTGCATTTTGGACACTTGCATACGT
  CCTTTCTCATCCTGATATCCACAAGGCCATTATGGAAGGCATATCTTCTGTGTTTGGCAAAGCAGGCAAA
  GATAAGATTAAAGTGTCTGAGGATGACCTGGAGAATCTCCTTCTAATTAAATGGTGTGTTTTGGAAACCA
  TTCGTTTAAAAGCTCCTGGTGTCATTACTAGAAAAGTGGTGAAGCCTGTGGAAATTTTGAATTACATCAT
  TCCTTCTGGTGACTTGTTGATGTTGTCTCCATTTTGGCTGCATAGAAATCCAAAGTATTTTCCTGAGCCT
  GAATTGTTCAAACCTGAACGTTGGAAAAAGGCAAATTTAGAGAAGCACTCTTTCTTGGACTGCTTCATGG
  CATTTGGAAGCGGGAAGTTCCAGTGTCCTGCAAGGTGGTTTGCTCTGTTAGAGGTTCAGATGTGTATTAT
  TTTAATACTTTATAAATATGACTGTAGTCTTCTGGACCCATTACCCAAACAGAGTTATCTCCATTTGGTG
  GGTGTCCCCCAGCCGGAAGGGCAATGCCGAATTGAATATAAACAAAGAATATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278739
• ORF Size: 894 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001278739.1, NP_001265668.1
• RefSeq Size: 2269
• RefSeq ORF: 894
• Locus ID: 51302
• Protein Families: Druggable Genome, P450, Transmembrane
• Protein Pathways: Primary bile acid biosynthesis
• Gene Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is involved in the conversion of cholesterol to bile acids. Its substrates include the oxysterols 25-hydroxycholesterol, 27-hydroxycholesterol and 24-hydroxycholesterol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (3) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.