WNT2B (NM_001291880) Human Untagged Clone

CAT#: SC335183

WNT2B (untagged) - Human wingless-type MMTV integration site family, member 2B (WNT2B), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: WNT2B
• Synonyms: WNT13
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001291880, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGTTCAGTGGGCGAGGGTGCCCGAGAATGGATCCGAGAGTGTCAGCACCAATTCCGCCACCACCGCT
  GGAACTGTACCACCCTGGACCGGGACCACACCGTCTTTGGCCGTGTCATGCTCAGAAGTAGCCGAGAGGC
  AGCTTTTGTATATGCCATCTCATCAGCAGGGGTAGTCCACGCTATTACTCGCGCCTGTAGCCAGGGTGAA
  CTGAGTGTGTGCAGCTGTGACCCCTACACCCGTGGCCGACACCATGACCAGCGTGGGGACTTTGACTGGG
  GTGGCTGCAGTGACAACATCCACTACGGTGTCCGTTTTGCCAAGGCCTTCGTGGATGCCAAGGAGAAGAG
  GCTTAAGGATGCCCGGGCCCTCATGAACTTACATAATAACCGCTGTGGTCGCACGGCTGTGCGGCGGTTT
  CTGAAGCTGGAGTGTAAGTGCCATGGCGTGAGTGGTTCCTGTACTCTGCGCACCTGCTGGCGTGCACTCT
  CAGATTTCCGCCGCACAGGTGATTACCTGCGGCGACGCTATGATGGGGCTGTGCAGGTGATGGCCACCCA
  AGATGGTGCCAACTTCACCGCAGCCCGCCAAGGCTATCGCCGTGCCACCCGGACTGATCTTGTCTACTTT
  GACAACTCTCCAGATTACTGTGTCTTGGACAAGGCTGCAGGTTCCCTAGGCACTGCAGGCCGTGTCTGCA
  GCAAGACATCAAAAGGAACAGACGGTTGTGAAATCATGTGCTGTGGCCGAGGGTACGACACAACTCGAGT
  CACCCGTGTTACCCAGTGTGAGTGCAAATTCCACTGGTGCTGTGCTGTACGGTGCAAGGAATGCAGAAAT
  ACTGTGGACGTCCATACTTGCAAAGCCCCCAAGAAGGCAGAGTGGCTGGACCAAACCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291880
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291880.1, NP_001278809.1
• RefSeq Size: 2854 bp
• RefSeq ORF: 900 bp
• Locus ID: 7482
• Cytogenetics: 1p13.2
• Protein Families: Secreted Protein
• Protein Pathways: Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
• Gene Summary: 'This gene encodes a member of the wingless-type MMTV integration site (WNT) family of highly conserved, secreted signaling factors. WNT family members function in a variety of developmental processes including regulation of cell growth and differentiation and are characterized by a WNT-core domain. This gene may play a role in human development as well as carcinogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]'
  Transcript Variant: This variant (3) differs in the 5' UTR and uses a downstream start codon, compared to variant WNT-2B2. The encoded isoform (3) has a shorter N-terminus, compared to isoform WNT-2B2.