TID1 (DNAJA3) (NM_001286516) Human Untagged Clone

CAT#: SC335200

DNAJA3 (untagged) - Human DnaJ (Hsp40) homolog, subfamily A, member 3 (DNAJA3), transcript variant 3


  "NM_001286516" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "DNAJA3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DNAJA3
Synonyms HCA57; hTID-1; TID1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286516, the custom clone sequence may differ by one or more nucleotides


ATGGCTGAGCCGCAAGCTGAGCGTCCCCGCCTTTGCGTCTTCCCTGACCTCTTGCGGCCCCCGAGCGCTG
CTGACATTGAGACCTGGTGTCAGCCTTACAGGAAGATCTTTGGCGAGTTCTCATCCTCTTCATTTGGAGA
TTTCCAGACCGTGTTTGATCAGCCTCAGGAATACTTCATGGAGTTGACATTCAATCAAGCTGCAAAGGGG
GTCAACAAGGAGTTCACCGTGAACATCATGGACACGTGTGAGCGCTGCAACGGCAAGGGGAACGAGCCCG
GCACCAAGGTGCAGCATTGCCACTACTGTGGCGGCTCCGGCATGGAAACCATCAACACAGGCCCTTTTGT
GATGCGTTCCACGTGTAGGAGATGTGGTGGCCGCGGCTCCATCATCATATCGCCCTGTGTGGTCTGCAGG
GGAGCAGGACAAGCCAAGCAGAAAAAGCGAGTGATGATCCCTGTGCCTGCAGGAGTCGAGGATGGCCAGA
CCGTGAGGATGCCTGTGGGAAAAAGGGAAATTTTCATTACGTTCAGGGTGCAGAAAAGCCCTGTGTTCCG
GAGGGACGGCGCAGACATCCACTCCGACCTCTTTATTTCTATAGCTCAGGCTCTTCTTGGGGGTACAGCC
AGAGCCCAGGGCCTGTACGAGACGATCAACGTGACGATCCCCCCTGGGACTCAGACAGACCAGAAGATTC
GGATGGGTGGGAAAGGCATCCCCCGGATTAACAGCTACGGCTACGGAGACCACTACATCCACATCAAGAT
ACGAGTTCCAAAGAGGCTAACGAGCCGGCAGCAGAGCCTGATCCTGAGCTACGCCGAGGACGAGACAGAT
GTGGAGGGGACGGTGAACGGCGTCACCCTCACCAGCTCTGGAAAAAGATCCACTGGAAACTAG


Restriction Sites SgfI-MluI     
ACCN NM_001286516
ORF Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001286516.1, NP_001273445.1
RefSeq Size 2314
RefSeq ORF 903
Locus ID 9093
Gene Summary This gene encodes a member of the DNAJ/Hsp40 protein family. DNAJ/Hsp40 proteins stimulate the ATPase activity of Hsp70 chaperones and play critical roles in protein folding, degradation, and multimeric complex assembly. The encoded protein is localized to mitochondria and mediates several cellular processes including proliferation, survival and apoptotic signal transduction. The encoded protein also plays a critical role in tumor suppression through interactions with oncogenic proteins including ErbB2 and the p53 tumor suppressor protein. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) lacks a segment in the 5' end and an alternate exon in the 3' end compared to variant 1. The resulting isoform (3) has shorter and distinct N- and C-termini compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.