WWOX (NM_001291997) Human Untagged Clone

CAT#: SC335202

WWOX (untagged) - Human WW domain containing oxidoreductase (WWOX), transcript variant 4


  "NM_001291997" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "WWOX"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol WWOX
Synonyms D16S432E; EIEE28; FOR; FRA16D; HHCMA56; PRO0128; SCAR12; SDR41C1; WOX1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001291997, the custom clone sequence may differ by one or more nucleotides


ATGGAAATTCTCCAGGGCCGGGATTTCACTGGCAAAGTGGTTGTGGTCACTGGAGCTAATTCAGGAATAG
GGTTCGAAACCGCCAAGTCTTTTGCCCTCCATGGTGCACATGTGATCTTGGCCTGCAGGAACATGGCAAG
GGCGAGTGAAGCAGTGTCACGCATTTTAGAAGAATGGCATAAAGCCAAGGTAGAAGCAATGACCCTGGAC
CTCGCTCTGCTCCGTAGCGTGCAGCATTTTGCTGAAGCATTCAAGGCCAAGAATGTGCCTCTTCATGTGC
TTGTGTGCAACGCAGCAACTTTTGCTCTACCCTGGAGTCTCACCAAAGATGGCCTGGAGACCACCTTTCA
AGTGAATCATCTGGGGCACTTCTACCTTGTCCAGCTCCTCCAGGATGTTTTGTGCCGCTCAGCTCCTGCC
CGTGTCATTGTGGTCTCCTCAGAGTCCCATCGATTTACAGATATTAACGACTCCTTGGGAAAACTGGACT
TCAGTCGCCTCTCTCCAACAAAAAACGACTATTGGGCGATGCTGGCTTATAACAGGTCCAAGCTCTGCAA
CATCCTCTTCTCCAACGAGCTGCACCGTCGCCTCTCCCCACGCGGGGTCACGTCGAACGCAGTGCATCCT
GGAAATATGATGTACTCCAACATTCATCGCAGCTGGTGGGTGTACACACTGCTGTTTACCTTGGCGAGGC
CTTTCACCAAGTCCATGCAACAGGGAGCTGCCACCACCGTGTACTGTGCTGCTGTCCCAGAACTGGAGGG
TCTGGGAGGGATGTACTTCAACAACTGCTGCCGCTGCATGCCCTCACCAGAAGCTCAGAGCGAAGAGACG
GCCCGGACCCTGTGGGCGCTCAGCGAGAGGCTGATCCAAGAACGGCTTGGCAGCCAGTCCGGCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001291997
ORF Size 906 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001291997.1, NP_001278926.1
RefSeq Size 2440
RefSeq ORF 906
Locus ID 51741
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) protein family. This gene spans the FRA16D common chromosomal fragile site and appears to function as a tumor suppressor gene. Expression of the encoded protein is able to induce apoptosis, while defects in this gene are associated with multiple types of cancer. Disruption of this gene is also associated with autosomal recessive spinocerebellar ataxia 12. Disruption of a similar gene in mouse results in impaired steroidogenesis, additionally suggesting a metabolic function for the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (4) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.