JUND (NM_001286968) Human Untagged Clone

CAT#: SC335218

JUND (untagged) - Human jun D proto-oncogene (JUND), transcript variant 1


  "NM_001286968" in other vectors (1)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "JUND"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol JUND
Synonyms AP-1
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286968, the custom clone sequence may differ by one or more nucleotides


ATGATGAAGAAGGACGCGCTGACGCTGAGCCTGAGTGAGCAGGTGGCGGCAGCGCTCAAGCCTGCGGCCG
CGCCGCCTCCTACCCCCCTGCGCGCCGACGGCGCCCCCAGCGCGGCACCCCCCGACGGCCTGCTCGCCTC
TCCCGACCTGGGGCTGCTGAAGCTGGCCTCCCCCGAGCTCGAGCGCCTCATCATCCAGTCCAACGGGCTG
GTCACCACCACGCCGACGAGCTCACAGTTCCTCTACCCCAAGGTGGCGGCCAGCGAGGAGCAGGAGTTCG
CCGAGGGCTTCGTCAAGGCCCTGGAGGATTTACACAAGCAGAACCAGCTCGGCGCGGGCGCGGCCGCTGC
CGCCGCCGCCGCCGCCGCCGGGGGGCCCTCGGGCACGGCCACGGGCTCCGCGCCCCCCGGCGAGCTGGCC
CCGGCGGCGGCCGCGCCCGAAGCGCCTGTCTACGCGAACCTGAGCAGCTACGCGGGCGGCGCCGGGGGCG
CGGGGGGCGCCGCGACGGTCGCCTTCGCTGCCGAACCTGTGCCCTTCCCGCCGCCGCCACCCCCAGGCGC
GTTGGGGCCGCCGCGCCTGGCTGCGCTCAAGGACGAGCCACAGACGGTGCCCGACGTGCCGAGCTTCGGC
GAGAGCCCGCCGTTGTCGCCCATCGACATGGACACGCAGGAGCGCATCAAGGCGGAGCGCAAGCGGCTGC
GCAACCGCATCGCCGCCTCCAAGTGCCGCAAGCGCAAGCTGGAGCGCATCTCGCGCCTGGAAGAGAAAGT
GAAGACCCTCAAGAGTCAGAACACGGAGCTGGCGTCCACGGCGAGCCTGCTGCGCGAGCAGGTGGCGCAG
CTCAAGCAGAAAGTCCTCAGCCACGTCAACAGCGGCTGCCAGCTGCTGCCCCAGCACCAGGTGCCCGCGT
ACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001286968
ORF Size 915 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001286968.1, NP_001273897.1
RefSeq Size 1963
RefSeq ORF 915
Locus ID 3727
Protein Families Druggable Genome, Transcription Factors
Protein Pathways MAPK signaling pathway
Gene Summary The protein encoded by this intronless gene is a member of the JUN family, and a functional component of the AP1 transcription factor complex. This protein has been proposed to protect cells from p53-dependent senescence and apoptosis. Alternative translation initiation site usage results in the production of different isoforms (PMID:12105216). [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (1) encodes two isoforms resulting from the use of alternative in-frame translation initiation codons. The longer isoform (JunD-FL) is derived from an upstream AUG (S1 ORF, PMID:12105216), while the shorter isoform (deltaJunD) is derived from a downstream AUG (S3 ORF, PMID:12105216). This RefSeq represents the shorter isoform (deltaJunD).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.