OR8G2P (NM_001291438) Human Untagged Clone

CAT#: SC335220

OR8G2 (untagged) - Human olfactory receptor, family 8, subfamily G, member 2 (OR8G2)


  "NM_001291438" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "OR8G2P"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol OR8G2P
Synonyms HSTPCR120; OR8G2; OR8G4; ORL206; ORL486; TPCR120
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001291438, the custom clone sequence may differ by one or more nucleotides


ATGGTTTTTCTTTCCTCCGTAGAAACTGACCAAAGGAAAATGTCAGCAGGAAACCATTCCTCAGTGACTG
AGTTCATTCTGGCTGGGCTCTCAGAACAGCCAGAGCTCCAGCTGCGCCTCTTCCTCCTGTTCTTAGGAAT
CTATGTGGTCACAGTGGTGGGCAACTTGAGCATGATCACACTGATTGGGCTCAGTTCTCACCTGCATACC
CCCATGTACTATTTCCTCAGTGGTCTGTCCTTCATTGATCTCTGCCATTCCACTATCATTACCCCCAAAA
TGCTGGTGAACTTTGTGACAGAGAAGAACATCATCTCCTACCCTGAATGCATGACTCAGCTTTACTTCTT
CCTCATTTTTGCTATTGCAGAGTGTCACATGTTGGCTGTAACGGCATATGACCGCTATGTTGCCATCTGC
AGCCCCTTGCTGTACAATGTCATCATGTCCTATCACCACTGCTTCTGGCTCACAGTGGGAGTTTACGTTT
TAGGCATCCTTGGATCTACAATTCACACCGGCTTTATGTTGAGACTCTTTTTGTGCAAGACTAATGTGAT
TAACCATTATTTTTGTGATCTCTTCCCTCTCTTGGGGCTCTCCTGCTCCAGCACCTACATCAATGAATTA
CTGGTTCTGGTCTTGAGTGCATTTAACATCCTGACGCCTGCCTTAACCATCCTTGCTTCTTACATCTTTA
TCATTGCCAGCATCCTCCGCATTCGCTCCACTGAGGGCAGGTCCAAAGCCTTCAGCACTTGCAGCTCCCA
CATCTTGGCTGTTGCTGTTTTCTTTGGGTCTGCAGCATTCATGTACCTGCAGCCATCATCTGTCAGCTCC
ATGGACCAGAGGAAAGTGTCCTCTGTGTTTTATACTACTATTGTGCCCATGCTGAACCCCCAATCTATAG
CCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001291438
ORF Size 915 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001291438.1, NP_001278367.1
RefSeq Size 1025
RefSeq ORF 915
Locus ID 26492
Protein Families Druggable Genome
Protein Pathways Olfactory transduction
Gene Summary Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.