FBXO4 (NM_001297437) Human Untagged Clone

CAT#: SC335229

FBXO4 (untagged) - Human F-box protein 4 (FBXO4), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FBXO4
• Synonyms: FBX4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001297437, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGGAAGCGAGCCGCGCAGCGGAACAAACTCGCCGCCGCCGCCCTTCAGCGACTGGGGCCGCCTGG
  AGGCGGCCATCCTCAGCGGCTGGAAGACCTTCTGGCAGTCAGTGAGCAAGGAGAGGGTGGCGCGTACGAC
  CTCACGGGAGGAGGTGGATGAGGCGGCCAGCACCCTGACGCGGCTGCCGATTGATGTACAGCTATATATT
  TTGTCCTTTCTTTCACCTCATGATCTGTGTCAGTTGGGAAGTACAAATCATTATTGGAATGAAACTGTAA
  GAGATCCAATTCTGTGGAGATACTTTTTGTTGAGGGATCTTCCTTCTTGGTCTTCTGTTGACTGGAAGTC
  TCTTCCAGATCTAGAAATCTTAAAAAAGCCTATATCTGAGGTCACTGATGGTGCATTTTTTGACTACATG
  GCAGTCTATAGAATGTGCTGTCCATACACAAGAAGAGCTTCAAAATCCAGCCGTCCTATGTATGGAGCTG
  TCACTTCTTTTTTACACTCCCTGATCATTCAGAATGAACCACGATTTGCTATGTTTGGACCAGGTTTGGA
  AGAATTGAATACCTCTTTGGTGTTGAGCTTGATGTCTTCAGAGGAACTTTGCCCAACAGCTGGTTTGCCT
  CAGAGGCAGATTGATGGTATTGGATCAGGAGTCAATTTTCAGTTGAACAACCAACATAAATTCAACATTC
  TAATCTTATATTCAACTACCAGAAAGGAAAGAGATAGAGCAAGGGAAGAGCATACAAGTGCAGTTAACAA
  GATGTTCAGTCGACACAATGAAGGTGATGATCAACAAGGAAGCCGGTACAGTGTGATTCCACAGATTCAA
  AAAGTGTGTGAAGTTGTAGATGGGTTCATCTATGTTGCAAATGCTGAAGCTCATAAAAGTCCAGGATACA
  GAGGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001297437
• ORF Size: 918 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001297437.1, NP_001284366.1
• RefSeq Size: 1335
• RefSeq ORF: 918
• Locus ID: 26272
• Protein Families: Druggable Genome
• Protein Pathways: Ubiquitin mediated proteolysis
• Gene Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (3) lacks an internal exon in the 3' coding region, which results in a translational frameshift, compared to variant 1. The resulting isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.