NPSR1 (NM_001300934) Human Untagged Clone

CAT#: SC335233

NPSR1 (untagged) - Human neuropeptide S receptor 1 (NPSR1), transcript variant 4


  "NM_001300934" in other vectors (1)

Reconstitution Protocol

USD 320.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "NPSR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NPSR1
Synonyms ASRT2; GPR154; GPRA; NPSR; PGR14; VRR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001300934, the custom clone sequence may differ by one or more nucleotides


ATGCCAGCCAACTTCACAGAGGGCAGCTTCGATTCCAGTGGGACCGGGCAGACGCTGGATTCTTCCCCAG
TGGCTTGCACTGAAACAGTGACTTTTACTGAAGTGGTGGAAGGAAAGGAATGGGGTTCCTTCTACTACTC
CTTTAAGACTGAGCAATTGATAACTCTGTGGGTCCTCTTTGTTTTTACCATTGTTGGAAACTCCGTTGTG
CTTTTTTCCACATGGAGGAGAAAGAAGAAGTCAAGAATGACCTTCTTTGTGACTCAGCTGGCCATCACAG
AAAAGCAAGCCAGGGTCCTCATTGTGATCGCCTGGAGCCTGTCTTTTCTGTTCTCCATTCCCACCCTGAT
CATATTTGGGAAGAGGACACTGTCCAACGGTGAAGTGCAGTGCTGGGCCCTGTGGCCTGACGACTCCTAC
TGGACCCCATACATGACCATCGTGGCCTTCCTGGTGTACTTCATCCCTCTGACAATCATCAGCATCATGT
ATGGCATTGTGATCCGAACTATTTGGATTAAAAGCAAAACCTACGAAACAGTGATTTCCAACTGCTCAGA
TGGGAAACTGTGCAGCAGCTATAACCGAGGACTCATCTCAAAGGCAAAAATCAAGGCTATCAAGTATAGC
ATCATCATCATTCTTGCCTTCATCTGCTGTTGGAGTCCATACTTCCTGTTTGACATTTTGGACAATTTCA
ACCTCCTTCCAGACACCCAGGAGCGTTTCTATGCCTCTGTGATCATTCAGAACCTGCCAGCATTGAATAG
TGCCATCAACCCCCTCATCTACTGTGTCTTCAGCAGCTCCATCTCTTTCCCCTGCAGGGAGCAAAGATCA
CAGGATTCCAGAATGACGTTCCGGGAGAGAACTGAGAGGCATGAGATGCAGATTCTGTCCAAGCCAGAAT
TCATCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001300934
ORF Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001300934.1, NP_001287863.1
RefSeq Size 1415
RefSeq ORF 918
Locus ID 387129
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a member of the vasopressin/oxytocin subfamily of G protein-coupled receptors. The encoded membrane protein acts as a receptor for neuropeptide S and affects a variety of cellular processes through its signaling. Increased expression of this gene in ciliated cells of the respiratory epithelium and in bronchial smooth muscle cells is associated with asthma. Polymorphisms in this gene have also been associated with asthma susceptibility, panic disorders, inflammatory bowel disease, and rheumatoid arthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4) lacks two consecutive in-frame exons in the central coding region, compared to variant 1. The encoded isoform (F, PMID: 15947423) is shorter, compared to isoform A.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.