Chromogranin A (CHGA) (NM_001301690) Human Untagged Clone

CAT#: SC335236

CHGA (untagged) - Human chromogranin A (parathyroid secretory protein 1) (CHGA), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHGA
• Synonyms: CGA
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301690, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGCTCCGCCGCTGTCCTGGCTCTTCTGCTCTGCGCCGGGCAAGTCACTGCGCTCCCTGTGAACAGCC
  CTATGAATAAAGGGGATACCGAGGTGATGAAATGCATCGTTGAGGTCATCTCCGACACACTTTCCAAGCC
  CAGCCCCATGCCTGTCAGCCAGGAATGTTTTGAGACACTCCGAGGAGATGAACGGATCCTTTCCATTCTG
  AGACATCAGAATTTACTGAAGGAGCTCCAAGACCTCGCTCTCCAAGGCGCCAAGGAGAGGGCACATCAGC
  AGAAGAAACACAGCGGTTTTGAAGATGAACTCTCAGAGGTTCTTGAGAACCAGAGCAGCCAGGCCGAGCT
  GAAAGGTCGGTCGGAGGCTCTGGCTGTGGATGGAGCTGGGAAGCCTGGGGCTGAGGAGGCTCAGGACCCC
  GAAGGGAAGGGAGAACAGGAGCACTCCCAGCAGAAAGAGGAGGAGGAGGAGATGGCAGTGGTCCCGCAAG
  GCCTCTTCCGGGGTGGGAAGAGCGGAGAGCTGGAGCAGGAGGAGGAGCGGCTCTCCAAGGAGTGGGAGGA
  CTCCAAACGCTGGAGCAAGATGGACCAGCTGGCCAAGGAGCTGACGGCTGAGAAGCGGCTGGAGGGGCAG
  GAGGAGGAGGAGGACAACCGGGACAGTTCCATGAAGCTCTCCTTCCGGGCCCGGGCCTACGGCTTCAGGG
  GCCCTGGGCCGCAGCTGCGACGAGGCTGGAGGCCATCCTCCCGGGAGGACAGCCTTGAGGCGGGCCTGCC
  CCTCCAGGTCCGAGGCTACCCCGAGGAGAAGAAAGAGGAGGAGGGCAGCGCAAACCGCAGACCAGAGGAC
  CAGGAGCTGGAGAGCCTGTCGGCCATTGAAGCAGAGCTGGAGAAAGTGGCCCACCAGCTGCAGGCACTAC
  GGCGGGGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301690
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001301690.1, NP_001288619.1
• RefSeq Size: 1626 bp
• RefSeq ORF: 921 bp
• Locus ID: 1113
• Cytogenetics: 14q32.12
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: 'The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. It is found in secretory vesicles of neurons and endocrine cells. This gene product is a precursor to three biologically active peptides; vasostatin, pancreastatin, and parastatin. These peptides act as autocrine or paracrine negative modulators of the neuroendocrine system. Two other peptides, catestatin and chromofungin, have antimicrobial activity and antifungal activity, respectively. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]'
  Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.