MAGEA2 (NM_001282502) Human Untagged Clone

CAT#: SC335279

MAGEA2 (untagged) - Human melanoma antigen family A, 2 (MAGEA2), transcript variant 5


  "NM_001282502" in other vectors (1)

Reconstitution Protocol

USD 320.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAGEA2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAGEA2
Synonyms CT1.2; MAGE2; MAGEA2A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282502, the custom clone sequence may differ by one or more nucleotides


ATGCCTCTTGAGCAGAGGAGTCAGCACTGCAAGCCTGAAGAAGGCCTTGAGGCCCGAGGAGAGGCCCTGG
GCCTGGTGGGTGCGCAGGCTCCTGCTACTGAGGAGCAGCAGACCGCTTCTTCCTCTTCTACTCTAGTGGA
AGTTACCCTGGGGGAGGTGCCTGCTGCCGACTCACCGAGTCCTCCCCACAGTCCTCAGGGAGCCTCCAGC
TTCTCGACTACCATCAACTACACTCTTTGGAGACAATCCGATGAGGGCTCCAGCAACCAAGAAGAGGAGG
GGCCAAGAATGTTTCCCGACCTGGAGTCCGAGTTCCAAGCAGCAATCAGTAGGAAGATGGTTGAGTTGGT
TCATTTTCTGCTCCTCAAGTATCGAGCCAGGGAGCCGGTCACAAAGGCAGAAATGCTGGAGAGTGTCCTC
AGAAATTGCCAGGACTTCTTTCCCGTGATCTTCAGCAAAGCCTCCGAGTACTTGCAGCTGGTCTTTGGCA
TCGAGGTGGTGGAAGTGGTCCCCATCAGCCACTTGTACATCCTTGTCACCTGCCTGGGCCTCTCCTACGA
TGGCCTGCTGGGCGACAATCAGGTCATGCCCAAGACAGGCCTCCTGATAATCGTCCTGGCCATAATCGCA
ATAGAGGGCGACTGTGCCCCTGAGGAGAAAATCTGGGAGGAGCTGAGTATGTTGGAGGTGTTTGAGGGGA
GGGAGGACAGTGTCTTCGCACATCCCAGGAAGCTGCTCATGCAAGATCTGGTGCAGGAAAACTACCTGGA
GTACCGGCAGGTGCCCGGCAGTGATCCTGCATGCTACGAGTTCCTGTGGGGTCCAAGGGCCCTCATTGAA
ACCAGCTATGTGAAAGTCCTGCACCATACACTAAAGATCGGTGGAGAACCTCACATTTCCTACCCACCCC
TGCATGAACGGGCTTTGAGAGAGGGAGAAGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282502
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282502.1, NP_001269431.1
RefSeq Size 1866 bp
RefSeq ORF 945 bp
Locus ID 4101
Cytogenetics Xq28
Gene Summary 'This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. This gene has two identical copies at different loci. Alternatively spliced transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (5) lacks two internal exons in the 5' UTR region, compared to variant 3. Variants 1 through 7 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.